Table 4

Putative hrp-boxes and candidate type III effector genes in WH6

Bit Score

hrp-box sequence

CDS*

Distance

from hrp-box

Translocation

Signal^


7.9

TGGAACTGAATAGCCAGTACTGACCAC

rspF

26

-


6.7

AGGAACCGATTCCGACAGATGGGCCAC

1942

77

A, B


5.3

CGGAACCTTTACCGGCACCTGAACACT

2917

248

A, B, C


5.1

TGGAACGAAATCGTCGATCAAACCACT

3173

58

A, C


5

TGGAACCGTATTGCGTAAGACGTCACT

1252

82

-


4.3

GGGAACCGCATCGGTTGCCTTCCAAC

3940

56

-


3.6

TGAAACCGGCACGGCGTGCCTGACCCT

rscR

324

A


1.2

TGGAACCAGGTGGGCGGGGCTTGCCAC

rspJ

33

A, B


Only coding sequences with no predicted homology or identifiable orthologs in Pf-5 or Pf0-1 are shown.

*PFWH6_# unless otherwise noted; ^N-terminal translocation signal scores were assigned based on "A"; >10% serine in first 50 amino acids, "B"; absence of aliphatic amino acids in position 3 or 4, and/or "C"; absence of negatively-charged amino acids in the first 12 amino acids [62].

Kimbrel et al. BMC Genomics 2010 11:522   doi:10.1186/1471-2164-11-522

Open Data