Table 5

Primer sequences for transposon display of D. pulex retroelements.

Oligos

Family

Primary primer

Secondary primer


Primers

Dpul_D16

CGTTAAGCCAGACCCACAGT

AGCGCCATCTCTCACCTATC

Dpul_D5

AGGCTACGGCCTTCAGTTTT

TCTCTCTCATTCCTTCCTTG

Reverse primer

GTAGACTGCGTACCAATTC

Adaptors

Adaptor Top

CTCGTAGACTGCGTACC

Adaptor Bottom

AATTGGTACGCAGTCTAC


Rho et al. BMC Genomics 2010 11:425   doi:10.1186/1471-2164-11-425

Open Data