Table 2

Primers used for qPCR.

Gene

Accession no.

Size (bp)

Forward primer

Reverse primer


Klf2

NM_001007684

96

CACACAGGTGAGAAGCCTTATCAT (874-897)

CCGTGTGCTTGCGGTAGTG (952-970)

Klf6

NM_031642

89

GCTCCCACTTGAAAGCACATC (641-661)

TTCTTGCAAAACGCCACTCA (710-729)

Klf10

NM_031135

149

CCATGAGCTGCGACTGGAA (183-201)

TAAGGTGGAGTCAAACAGAATGCT (307-331)

Klf11

NM_001037354

85

CCTGATCTACCAAAGGACTTCCA (311-333)

CTCATGGAGCCAACAGGGA (377-395)

Klf15

NM_053536

65

TGCGGCTGGAGGTTTTCA (1347-1364)

TTCACACCCGAGTGAGATCGT (1391-1411)

Klf16

NM_001127604

79

TCACACCTGCGGACTCACA (516-534)

CGGAACGGGCGAACTTCT (577-594)

Rps3

NM_001009239

94

AAAGTGGCCACAAGAGGTCTGT (280-301)

CATAGCAGGCCCTTCGAACT (354-373)

Rps6

NM_017160

82

AAGGTAAGAAGCCCAGGACCAA (509-530)

ATACGTCGGCGTTTGTGTTG (571-590)


mRNA sequences (accession numbers provided) for established genes were obtained from the Rat Genome Database (http://rgd.mcw.edu webcite, viewed at http://www.ncbi.nlm.nih.gov/entrez webcite). Nucleotide positions are shown in parentheses for each primer.

Markou et al. BMC Genomics 2010 11:343   doi:10.1186/1471-2164-11-343

Open Data