Table 1

Identification of novel TOP mRNAs.

Gene Symbol

Polysome RNA

Total RNA

5' UTR


Atg12

1.28

1.03

Mouse:CTTCCGCCGCCGCCTCTCAGCAAGCAAAGATG

Rat:    CTTCCGCCGTCGACGCTCAGCAAGCAAGATG


Atp5g2

1.26

1.00

Mouse:CCCTCTCTGTCTTCTCTGCCCTGGGAGCAGCCCTCCTGCCTCGGCCCCTCACCCCTGAAAATG

Rat:    CCCTCTCTGTCTTCTCTACCCTGGGAGCAGCTCTTCTGCCTTTGCCCCTCACCCCTGAAAAATG


Ccnj

1.52

1.20

Mouse:CTTCCAGACTGAAGTTGCGGCGTCTGGCCGGGCGCACCTCCGGCTTCCATG

Rat:    CTTCCAGACTGAAGTTGCGGCGTCTGGCTGGGCGCGCCTCCGGCTTCCATG


Cnih

1.25

1.02

Mouse:CTTTCTCCGCTGGCCCCGGCGCGCCCGGCAGCTCCTCCCCGGCCATG

Rat:    CTTTCTCCGCTGGCCCCGGCGCGCCCGGCAGCTCCTCCCCGGCCATG


Gltscr2

1.28

0.91

Mouse:CTTCCTTTAAGAAGATG

Rat:    CTTCCTTTAAGAAGATG


Naca

1.25

0.96

Mouse:CTCTTTCTGCCGCCATCTTGGTTCCGTGATCTCCGCACAAAATG

Rat:    CTCTTTCCACCGCCATCTTGGTTCCGTGTTCTCCGCACAAAATG


Pfdn5

1.28

0.90

Mouse:CTTCCTCTTCGGCAGTCCTCCTTCCCAACATG

Rat:    CTTCCGCTTCGGCATTCCTCCTTCCCAACATG


Rbms2

1.27

0.96

Mouse:CTCCCTCCCTTTCCTTCACTCTCTTCTTTCTCTCTCTCAGCTCCGTAACAGTAAAGAAAAAATG

Rat:    CTCCCTCCCTTTCCTTCACTCTCTTCTTTCTCTCTCTCAGCTCCGTAACAGTAAAGAAAAAATG


Total and polysomal RNA from cardiomyocytes exposed to insulin (50 mU/ml, 1 h) or unstimulated cardiomyocytes (controls) were analysed using microarrays. Probesets corresponding to mRNAs with >1.25-fold increase in expression (FDR < 0.05) were identified. Results are the mean fold change in insulin stimulated samples relative to controls. Mouse and rat 5' UTR sequences were identified. The TOP sequence is in bold italics. Accession numbers are provided in Additional data file 6.

Markou et al. BMC Genomics 2010 11:343   doi:10.1186/1471-2164-11-343

Open Data