Table 2

Porcine miRNAs with hairpin forming precursors and genomic locations.

conserved miRBase 14.0

internal ID

mature sequence

precursor sequence

mfe (kcal/mol)

gen. location

subject ID

start

end


Genomic duplications

ssc-miR-194

MDM9

UGUAACAGCGACUCCAUGUGGAC

UGUAACAGCGACUCCAUGUGGACUGUGCCCCAAUUUCCAGUGGAGAUGCUGUUACCUU

-37.4

X

emb|FP565626.1|

43462

43519

10

emb|CU466937.2|

6280

6223


ssc-miR-365-1

MDM48

UAAUGCCCCUAAAAAUCCUUAU

GAGGGACUUUUGGGGGCAGAUGCGUUUCCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAU

-33.8

3

emb|CU896561.2|

167752

167814

ssc-miR-365-2

MDM45

UAAUGCCCCUAAAAAUCCUUAU

GAGGGACUUUCAGGGGCAGCUGUGUUUUCUGACUCAGUCAUAAUGCCCCUAAAAAUCCUUAU

-35

12

emb|FP016089.2|

194688

194749


MDM123

AAACGAUGAUGGAAGGUGCUGAGGA

CUCUCUGGUCCCUUCUCUCCCCUCUUCAUGGUUGACAGCAACCCCAGAAACGAUGAUGGAAGGUGCUGAGGA

-35.4

2

emb|CU896534.2|

31001

30933

MDM266

AAACGAUGAUGGAAGGUGCUGAGGA

AAACGAUGAUGGAAGGUGCUGAGGAAGGGGUGCUAAUGUCCUAGCGUUUCCUCCUUCCAUUGUUAGGAGGC

-32.7

ND

ND

ND

ND


MDM208

UCUGGCUGUGGUGUAGGCCGU

GGAUCUGCGCAUUGCCGCGAGCUGCAGUGUAGGUCACAGAUGUGGCUCAGAUCCAGCAUUGCUCUGGCUGUGGUGUAGGCCGU

-40.3

16

emb|CU571054.2|

59166

59247

MDM116

UCUGGCUGUGGUGUAGGCCGUC

AGGUCACAAACACGGCUCAGAUCUGAUGUUGCUCUGGCUGUGGUGUAGGCCGUC

-41

13

emb|CU582976.2|

156369

156318


mmu-miR-1896

MDM214

AUGGGUGAGGAGUGUUGUGUAUAUA

AUGGGUGAGGAGUGUUGUGUAUAUAUAUUUGUGUGUUUGUAUAUACACAUCUCAAAGCUUAUUU

-27.2

6

emb|FP236156.2|

77046

76983


16

emb|FP085480.3|

108843

108906


hsa-miR-1977

MDM262

GACUUGGAAUUAGUAGGGUGCUUA

GACUUGGAAUUAGUAGGGUGCUUAGAACAGUGCCUGAUACAUAGUUUCACAA

-26.2

4

emb|FP236645.1|

179755

179704

14

emb|CT737346.2|

42310

42361


MDM284

GCCGCGGCGUCCGGGCUG

GCCGCGGCGUCCGGGCUGUGUCCGCCCUGGCGGGCGCGCGGGGGCGGGAAGGCGCGGGCUGUCAAGGGCGCUGCGGCAG

-61

X

emb|CU466457.2|

83369

83334

13

emb|CU582896.2|

20953

20988


Genomic clusterings

ssc-miR-215

MDM1

UGACCUAUGAAUUGACAGACA

UGACCUAUGAAUUGACAGACAAUGUGGCUAAAUCUGUCUGUCAUUUCUGUAGGCCAAU

-29.8

X & 10

emb|FP565626.1|

43758

43815

ssc-miR-194

MDM9

UGUAACAGCGACUCCAUGUGGAC

UGUAACAGCGACUCCAUGUGGACUGUGCCCCAAUUUCCAGUGGAGAUGCUGUUACCUU

-37.4

X & 10

emb|FP565626.1|

43462

43519


ssc-miR-421

MDM86

AUCAACAGACAUUAAUUGGGCGC

CCUCAUUAAAUGUUUGUUGAAUGAAAAAAUGAAUCAUCAACAGACAUUAAUUGGGCGC

-35.8

ssc-miR-374a

MDM23

UUAUAAUACAACCUGAUAAGUG

UUAUAAUACAACCUGAUAAGUGUUACAGCACUUAUCAGGUUGUAUUGUAAUU

-41.2


bta-miR-2316

MDM279

CGGCCGGAGCCUGGACUGCUGC

GGCGCUAGGGAGCCAGGCCGGGGAGGACAGCUGCAGCCAGCCUGUCCUCCCGUCCGGCCGGAGCCUGGACUGCUGC

-63.5

15

emb|CU914511.2|

63040

62965

MDM371

CGCGGGUGGGAAUGGGAAGG

CCCCCACCCCCGCCCCGGCUGACGCAAGAACCUGGCGGGCCGCGGGUGGGAAUGGGAAGG

-49.5

15

emb|CU914511.2|

63388

63431


Alternatively predicted precursors

MDM62

UGUGUCUGUGGCCUAGGCUGGCAG

UGUGUCUGUGGCCUAGGCUGGCAGGCAGCUGCAGCUCCAGUUCAACCCCUAGCCUGGGAACUUCCAUAUGCUCAGG

-36.4

9

emb|CU915614.1|

87273

87348

MDM109

UGUGUCUGUGGCCUAGGCUGGCAG

GAGACAUGGUGUAGGUUGCAGACGUGGCUCAGAUCUGGCAUUGCUGUGUCUGUGGCCUAGGCUGGCAG

-46.9

9

emb|CU915614.1|

87229

87296


MDM128

GCCGGAGCUGGAGGUGGG

GCCGGAGCUGGAGGUGGGCGAGGCCGCGGCACCCCCUCCGCUGCCGCCGCCGAGGGCCGCCUCCCUGGCCUCGGUGC

-52.7

17

emb|FP325255.2|

141939

141863

MDM129

GCCGGAGCUGGAGGUGGG

CCUCUUCAGCGAGCGCGGCCGCUCCGUGCCCCUCGAGGAGCUGCCGGAGCUGGAGGUGGG

-50.4

17

emb|FP325255.2|

141981

141922


MDM196

AGAGGUUCGGCUGUGCGGGCA

CUCCGCGGCGCUCGGAUAUCUGGCAGACCCGGGCGCGGGGAGGCUAGAGGUUCGGCUGUGCGGGCA

-50.6

3

emb|FP475960.2|

151377

151312

MDM382

AGAGGUUCGGCUGUGCGGGCA

AGAGGUUCGGCUGUGCGGGCACUGCGCUCCGGGGACGGCCGCUGCACCUGC

-29.2

3

emb|FP475960.2|

151332

151282


mmu-miR-2145

MDM238

AUCAGGGUCGGGCCUGG

AGUGCCACCCUGAAUGCACCCGAUCUCAUCUGAUCUUGGAGGCUAAUCAGGGUCGGGCCUGG

-34.8

2

emb|CU929491.4|

132342

132283

mmu-miR-2145

MDM392

AUCAGGGUCGGGCCUGG

AUCAGGGUCGGGCCUGGUACUUGGUAGGGAGACAUGAGAUUUGGACCCAGAUCUGAUUA

-28.8

2

emb|CU929491.4|

132299

132241


The chromosomal organization of selected miRNAs that were identified by miRDeep either showing valid expression in microarray experiments or being conserved was determined by blasting against the porcine HTGS database at NCBI. Identified genomic duplications, clustering and alternatively predicted precursors are shown. Abbreviation: ND, not determined

Sharbati et al. BMC Genomics 2010 11:275   doi:10.1186/1471-2164-11-275

Open Data