Table 4

Top 20 differentially expressed miRNAs between WT and MT

miRNA

Sequence

WT counta

MT counta

Fold change

p-value


Higher expression in MT

csi-miR479

UGUGAUAUUGGUUCGGCUCAUC

1341.6

1921.5

1.9

0

csi-miR156a

UGACAGAAGAGAGUGAGCAC

856.2

1656.1

2.6

0

csi-miR167a

UGAAGCUGCCAGCAUGAUCUA

759.6

1967.3

21.6

0

csi-miR171b

CGAGCCGAAUCAAUAUCACUC

28.5

615.4

4.5

0

csi-novel-08

UAGAUAAAGAUGAGAGAAAAA

220.1

1248.5

1.5

0

csi-miR166j

UCUCGGACCAGGCUUCAUUCC

1682.9

2078.5

3.1

2.85E-22

Lower expression in MT

csi-miR482a

UCUUCCCUAUGCCUCCCAUUCC

103.9

4.2

15.6

0

csi-miR162a

UCGAUAAACCUCUGCAUCCAG

401.0

25.7

12.4

0

csi-miR159a

UUUGGAUUGAAGGGAGCUCUA

307.8

24.8

3.5

0

csi-miR390a

AAGCUCAGGAGGGAUAGCGCC

822.2

235.8

2.5

0

csi-miR164a

UGGAGAAGCAGGGCACGUGCA

1894.0

749.0

1.6

0

csi-miR167d

UGAAGCUGCCAGCAUGAUCUGA

1362.3

825.8

1.4

0

csi-miR172a

AGAAUCUUGAUGAUGCUGCAU

4688.4

3299.7

1.4

0

csi-novel-11

UGGACAGAGAAAUCACGGUCA

591.5

132.7

5.7

0

csi-miR156b

CUGACAGAAGACAGUGAGCAC

41.3

1.8

2.5

2.86E-27

csi-miR473a

ACUCUCCCUCAAGGGCUUCGC

168.1

68.1

1.2

2.01E-26

csi-novel-03

UGAAGGGCCUUUCUAGAGCAC

90.5

29.6

8.1

2.87E-20

csi-miR399a

UGCCAAAGGAGAAUUGCCCUG

36.3

4.5

13.8

3.14E-18

csi-miR482c

UCUUGCCCACCCCUCCCAUUCC

29.0

2.1

15.6

8.98E-18

Csi-miR164d

UGGAGAAGCAGGGCACGUGCU

49.1

11.1

4.4

7.6E-17


a count was normalized as transcripts per million (TPM).

Xu et al. BMC Genomics 2010 11:246   doi:10.1186/1471-2164-11-246

Open Data