Table 3

Primer sequences in real- time RT-PCR reactions and products' sizes

Gene

Primer

Sequence (5' - 3')

Amplicon (bp)


GAPDH

Forward

TGCCCAGAATATCATCCC

134

Reverse

AGGTCAGATCCACAACAG

PHLDA2

Forward

CCTAAGTCCCACGGCGAATC

109

Reverse

CTATATCCTTGCCCTGGTCAGC

FERMT2

Forward

GATTAGGATGGACGCCAGCAC

128

Reverse

AGGACAACCGTACTTCATCTGC

SHISA2

Forward

GCGGCTGCGACAACGATC

130

Reverse

ATGAAGGCGACAAACACTGACC

RP2

Forward

AAGCACCTGACTTCCTTCCTC

119

Reverse

CTTGGTCCCTTTGAATGTCTCG

TGFBR3

Forward

TCGCTGGATGCCTCAATG

140

Reverse

ATCTGTGGAGTAATTGGAATCG

MCF2L

Forward

TGAGCCTGGAGGGATACG

110

Reverse

GCCATCGTTGTCCTCAGG

SLC11A2

Forward

TGCAGTGGTCAGCGTAGC

111

Reverse

TTAGAGATGCTTACCGTGTGC

SERPINC1

Forward

AAGTCCAGGCTCCCAGGTATTG

142

Reverse

GCGAACGACCAGCGATGC

FDFT1

Forward

GGTCACCCTGATGATGGATGC

139

Reverse

CCTGATGGTGGAGATGATCTGC

ACTB

Forward

AGGCCAACCGTGAGAAGATGAC

100

Reverse

CCAGAGGCATACAGGGACAGC

RPLP0

Forward

GACAATGGCAGCATCTAC

198

Reverse

GAAGGTGTAATCAGTCTC


Huang et al. BMC Genomics 2010 11:23   doi:10.1186/1471-2164-11-23

Open Data