Table 1

miRNAs identified in Ae. albopictus C7/10 cells and predicted in Ae. aegypti.

C710

# miRNA

# miRNA*

Sequence

Length

aga

ame

dme

Ae. aegypti

Start

End

Strand


184

1487481

0

UGGACGGAGAACUGAUAAGGGC

22

Y

Y

Y

1.496

143378

143399

Minus

275

23841

78

UCAGGUACCUGAAGUAGCGC

20

Y

Y

Y

1.24

486591

486610

Plus

277

4453

7

UAAAUGCACUAUCUGGUACGAC

22

Y

Y

Y

1.265

508860

508881

Plus

9

4085

602

UCUUUGGUAUUCUAGCUGUAGA

22

Y

Y

Y

1.785

186231

186252

Plus

8-3p

3002

-

UAAUACUGUCAGGUAAAGAUGUC

23

Y

Y

Y

1.411

876091

876113

Plus

252.1

1608

13

UAAGUACUAGUGCCGCAGGAG

21

Y

Y

Y

1.56

1580060

1580080

Minus

bantam-5p

1384

-

CCGGUUUUCAUUUUCGAUCUGAC

23

Y

Y

Y

1.49

157893

157915

Minus

71

1246

17

AGAAAGACAUGGGUAGUGAGAU

22

?

Y

?

1.268

889428

889449

Minus

8-5p

1244

-

CAUCUUACCGGGCAGCAUUAGA

22

Y

Y

Y

1.411

876052

876073

Plus

276-1

1209

4

UAGGAACUUCAUACCGUGCUC

21

Y

Y

Y

1.5

2769510

2769530

Minus

276-2

-

-

UAGGAACUUCAUACCGUGCUC

21

Y

Y

Y

1.134

39026

39046

Plus

317-1

1118

0

UGAACACAGCUGGUGGUAUCU

21

Y

Y

Y

1.265

429503

429523

Plus

317-2

-

-

UGAACACAGCUGGUGGUAUCU

21

Y

Y

Y

1.153

2154717

2154737

Minus

283

947

0

CAAUAUCAGCUGGUAAUUCUGGGC

24

Y

Y

Y

1.68

2729393

2729416

Minus

252.2

888

-

CUAAGUACUAGUGCCGCAGGAG

22

Y

Y

Y

1.56

1580060

1580081

Minus

let-7

650

0

UGAGGUAGUUGGUUGUAUAGU

21

Y

Y

Y

1.43

1156331

1156351

Plus

2

708

1

UAUCACAGCCAGCUUUGAAGAGC

23

Y

Y

Y

1.268

888597

888619

Minus

998

561

0

UAGCACCAUGAGAUUCAGC

19

?

?

Y

1.744

322338

322356

Plus

92b

530

0

AAUUGCACUUGUCCCGGCCUG

21

Y

Y

Y

1.116

1319201

1319221

Plus

1889-3p

478

-

CACGUUACAGAUUGGGGUUUCC

22

Y

?

?

1.68

2720796

2720817

Minus

bantam-3p

475

-

UGAGAUCAUUUUGAAAGCUGAU

22

Y

Y

Y

1.49

1579555

1579576

Minus

306

454

81

UCAGGUACUGAGUGACUCUCAG

22

Y

?

Y

1.785

213078

213099

Plus

281

398

1

AAGAGAGCUAUCCGUCGAC

19

Y

Y

Y

1.957

134462

134480

Plus

1889-5p

378

-

UAAUCUCAAAUUGUAACAGUGG

22

Y

?

?

1.68

2720896

2720917

Minus

980

309

6

UAGCUGCCUAGUGAAGGGC

19

?

?

Y

1.23

1043069

1043087

Plus

278

286

53

ACGGACGAUAGUCUUCAGCGGCC

23

Y

Y

Y

1.16

3596269

3596291

Plus

989

242

0

UGUGAUGUGACGUAGUGGUAC

21

Y

?

Y

1.115

804187

804207

Minus

14

247

0

UCAGUCUUUUUCUCUCUCCUAU

22

Y

Y

Y

1.249

1089019

1089040

Minus

11

222

31

CAUCACAGUCUGAGUUCUUGCU

22

Y

?

Y

1.744

322062

322083

Plus

190

210

0

AGAUAUGUUUGAUAUUCUUGGUUG

24

Y

Y

Y

1.195

82254

82277

Minus

1

169

0

UGGAAUGUAAAGAAGUAUGGAG

22

Y

Y

Y

1.812

291373

291394

Plus

34

147

1

UGGCAGUGUGGUUAGCUGGUUG

22

Y

?

Y

1.265

509536

509557

Plus

1890

123

0

UGAAAUCUUUGAUUAGGUCUGG

22

Y

?

?

1.204

1733356

1733377

Plus

988

118

24

CCCCUUGUUGCAAACCUCACGC

22

Y

?

Y

1.442

623057

623078

Minus

957

99

0

UGAAACCGUCCAAAACUGAGGC

22

Y

?

Y

1.7

464339

464360

Plus

305

96

4

AUUGUACUUCAUCAGGUGCUCUGG

24

Y

Y

Y

1.24

495601

495624

Plus

996

88

0

UGACUAGAUUACAUGCUCGUC

21

Y

Y

Y

1.437

567507

567527

Minus

87

79

0

GUGAGCAAAUUUUCAGGUGUGU

22

Y

Y

Y

1.36

1010846

1010867

Plus

12

68

3

UGAGUAUUACAUCAGGUACUGGU

23

Y

Y

Y

1.68

2720468

2720490

Minus

13

57

1

UAUCACAGCCAUUUUGACGAGUU

23

Y

Y

Y

1.268

888744

888766

Minus

92a

44

0

UAUUGCACUUGUCCCGGCC

19

Y

Y

Y

1.116

1267254

1267272

Plus

33

40

0

GUGCAUUGUAGUUGCAUUGCA

21

?

Y

Y

1.487

351656

351676

Plus

279

36

2

UGACUAGAUCCACACUCAUUAA

22

Y

Y

Y

1.437

572258

572279

Minus

79

33

6

GCUUUGGCGCUUUAGCUGUAUGA

23

Y

Y

Y

1.785

213277

213299

Plus

263

32

0

AAUGGCACUGGAAGAAUUCACGG

23

Y

Y

Y

1.981

164999

165021

Minus

7

32

0

UGGAAGACUAGUGAUUUUGUUGU

23

Y

Y

Y

1.1359

46041

46063

Plus

**2945

32

0

UGACUAGAGGCAGACUCGUUUA

22

Y

?

?

1.43

481083

481105

Plus

100-5p

30

-

AACCCGUAGAUCCGAACUUGUG

22

Y

Y

Y

1.43

1142184

1142205

Plus

100-3p

25

-

CAAGAACGGAUGUAUGGGAUUC

22

Y

Y

Y

1.43

1142224

1142245

Plus

970

21

0

UCAUAAGACACACGCGGCUAU

21

Y

?

Y

1.229

1045875

1045895

Plus

210.1

13

0

CUUGUGCGUGUGACAACGG

19

Y

Y

Y

1.512

515650

515668

Plus

999

14

0

UGUUAACUGUAAGACUGUGUCU

22

?

?

Y

1.100.

2315145

2315166

Plus

308

16

4

CGCGGUAUAUUCUUGUGGCUUG

22

Y

?

Y

1.107

508980

509001

Plus

125

7

3

UCCCUGAGACCCUAACUUGUGA

22

Y

Y

Y

1.43

1156615

1156636

Plus

210.2

6

0

UUGUGCGUGUGACAACGGCUAU

22

Y

Y

Y

1.512

515646

515667

Plus

307

6

0

CACAACCUCCUUGAGUGAGCGA

22

Y

?

Y

1.16

1859430

1859451

Minus

1000-1

6

0

AUAUUGUCCUGUCACAGCAGU

21

Y

Y

Y

1.187

325478

325498

Plus

1000-2

-

-

AUAUUGUCCUGUCACAGCAGU

21

Y

Y

Y

1.3798

224

244

Minus

375

4

0

UUUGUUCGUUUGGCUCGAGUUA

22

Y

Y

Y

1.309

1318752

1318773

Minus

309-1

4

-

UCACUGGGCAAAGUUUGUCGCA

22

Y

?

Y

1.15

907938

907959

Plus

309-2

-

-

UCACUGGGCAAAGUUUGUCGCA

22

Y

?

Y

1.602

94088

94109

Plus

932

3

-

UGCAAGCAAUGUGGAAGUGAAG

22

?

Y

Y

1.1064

154192

154213

Minus

315

2

0

UUUUGAUUGUUGCUCAGAAAGC

22

Y

Y

Y

1.612

104143

104164

Plus

927

1

0

CAAAGCGUUUGGAUUCUGAAAC

22

Y

Y

Y

1.26

2065461

2065482

Plus

**2943

1

0

UUAAGUAGGCACUUGCAGGC

20

Y

?

?

1.348

212450

212470

Plus

1891-1

predicted

UGAGGAGUUAAUUUGCGUGUUU

22

Y

?

?

1.199

1109750

1109771

Minus

1891-2

predicted

UGAGGAGUUAAUUUGCGUGUUU

22

Y

?

?

1.466

72802

72823

Plus

1175

predicted

AAGUGGAGUAGUGGUCUCAUCG

22

Y

?

?

1.125

1648037

1648058

Plus

1174

predicted

UCAGAUCUACUUAAUACCCAU

21

Y

?

?

1.125

1647921

1647941

Plus

993

predicted

UACCCUGUAGUUCCGGGCUUUU

22

Y

Y

Y

1.056

256798

256819

Plus

981

predicted

UUCGUUGUCGACGAAACCUGCA

22

Y

Y

Y

1.127

638380

638401

Minus

965

predicted

UAAGCGUAUAGCUUUUCCCAUU

22

Y

?

Y

1.51

2008701

2008722

Plus

316

predicted

UGUCUUUUUCCGCUUACUGCCG

22

?

Y

Y

1.289

891327

891348

Minus

285

predicted

UAGCACCAUUCGAAAUCAGUAC

22

?

?

Y

1.26

3339153

3339174

Minus

137-1

predicted

UAUUGCUUGAGAAUACACGUAG

22

Y

Y

Y

1.1191

97844

97865

Plus

137-2

predicted

UAUUGCUUGAGAAUACACGUAG

22

Y

Y

Y

1.137

260684

260705

Minus

133

predicted

UUGGUCCCCUUCAACCAGCUGU

22

Y

Y

Y

1.778

350306

350327

Minus

124

predicted

UAAGGCACGCGGUGAAUGC

19

Y

Y

Y

1.6

1664623

1664641

Minus

31

predicted

UGGCAAGAUGUUGGCAUAGCUGA

23

?

Y

Y

1.636

483257

483279

Minus

10

predicted

ACCCUGUAGAUCCGAAUUUGUU

22

Y

Y

Y

1.44

813557

813578

Plus

iab-4-1

predicted

ACGUAUACUGAAUGUAUCCUGA

22

Y

Y

Y

1.708

50265

50286

Plus

iab-4-2

predicted

ACGUAUACUGAAUGUAUCCUGA

22

Y

Y

Y

1.423

763526

763547

Minus

2940

125253

4125

UGGUUUAUCUUAUCUGUCGAGGC

23

?

?

?

1.222

643960

643982

Plus

2765

1162

0

UGGUAACUCCACCACCGUUGGC

22

Y

?

?

1.11

5248310

5248331

Plus

2951

1136

28

AAGAGCUCAGUACGCAGGGG

20

?

?

?

multiple

2941-1

9

0

UAGUACGGCUAGAACUCCACGG

22

?

?

?

1.385

413147

413168

Minus

2941-2

-

-

UAGUACGGCUAGAACUCCACGG

22

?

?

?

1.385

413451

413472

Minus


aga = An. gambiae; ame = Ap. mellifera; dme = D. melanogaster.

Top group: miRNAs and miRNA* strands identified by deep sequencing

Middle group: predicted miRNAs identified in Cx. quinquefasciatus but absent from C7/10 cells were cross-referenced with the Ae. aegypti (AaegL1)

Bottom group: novel miRNAs identified in this study. miR-2765 (not present in miRBase v14) has recently been identified in Bombyx mori.

** novel miRNAs (not present in miRBase v14) recently identified in Ae. aegypti mosquitoes while this manuscript was under review

Skalsky et al. BMC Genomics 2010 11:119   doi:10.1186/1471-2164-11-119

Open Data