Table 3

Four TTSs overlapped with mir-483 precursor

TTS ID

Sequence

TTS Length

Chromosome

Start

End

Strand

%G

sno/miRNA ID


TTS15011002111984

GGGAGGAAAGAAGGGAGTGG

20

chr11

2111984

2112003

reverse

60

hsa-mir-483

TTS15011002111953

GGGAGGAGAGGAGTGAGGAGG

21

chr11

2111953

2111973

forward

67

hsa-mir-483

TTS15011002111932

AAGGGCAGGAGAGGAGAAGA

20

chr11

2111932

2111951

forward

50

hsa-mir-483

TTS15011002112005

GTGGGGGAGAGGGGGAAGA

19

chr11

2112005

2112023

reverse

68

hsa-mir-483


Jenjaroenpun and Kuznetsov BMC Genomics 2009 10(Suppl 3):S9   doi:10.1186/1471-2164-10-S3-S9

Open Data