Table 1

The designed primers for CYP2D6 analysis obtained from RExPrimer

Name

Sequence 5' → 3'

Purpose


CYP2D6_1F

GGCCTACCCTGGGTAAGGGCCTGGAGCAGGA

whole gene amplification

CYP2D6_1R

CTCAGCCTCAACGTACCCCTGTCTCAAATGCG


CYP2D6_2F

GAGACTCCTCGGTCTCTCG

penta-plex PCR

CYP2D6_2R

TAATGCCTTCATGGCCACGCG


CYP2D6_3F

AGGCCTTCCTGGCAGAGATGAAG

penta-plex PCR

CYP2D6_3R

CCCCTGCACTGTTTCCCAGA


CYP2D6_4F

CCAGCCACCATGGTGTCTTTG

penta-plex PCR

CYP2D6_4R

GCCTCAACGTACCCCTGTCTC


DMD_F

TTGTCGGTCTCCTGCTGGTCAGTG

one-copy internal standard in penta-plex PCR

DMD_R

CAAAGCCCTCACTCAAACATGAAGC


LDL_F

TACAAGTGCCAGTGTGAGGAAG

two-copy internal standard in penta-plex PCR

LDL_R

GTGCAAAGTTCAGAGGATGAAACT


Rows 2-6 represent semiquantitative analysis of CNV

Piriyapongsa et al. BMC Genomics 2009 10(Suppl 3):S4   doi:10.1186/1471-2164-10-S3-S4

Open Data