Table 1

Overgo and primer sequences

Name

Description

Sequence


CMOF

C-mos overgo, forward

TGGAGGATGGCTTATCTCTGAG

CMOR

C-mos overgo, reverse

GGCAAATATTGGGGCTCAGAGA

CR1aOF

CR1a overgo, forward

AGCGGAGGTGGTTCAAGCACCT

CR1aOR

CR1a overgo, reverse

AAGGTGTTCAATGTAGGTGCTT

CR1bOF

CR1b overgo, forward

AATAGGTCCAAGGAGGTGATAC

CR1bOR

CR1b overgo, reverse

CCGATAGAGGGGAAGTATCACC

CMF1

C-mos forward primer1

ATCACGGCAGAGCTTCTGGG

CMR1

C-mos reverse primer1

TGGCAAATATTGGGGCTCAG

CMF2

C-mos forward primer 2

GTTGTGCAAGATCGGAGACT

CMR2

C-mos reverse primer 2

GACGTAACTGGGCTACATTC


Shan et al. BMC Genomics 2009 10(Suppl 2):S9   doi:10.1186/1471-2164-10-S2-S9

Open Data