Table 1

The locations of 24 miRNAs downstream of Alu elements in the human genome.

Id-Alu

Chr

Strand

Seq


Intergenic


AluSx-11437

chr1

+

CTACTCGGGAGGCTGAGGCAGGA

AluSq/x-173806

chr2

+

AGGTCAGGAGTTTGAGACCA

AluSg/x-1110454*

chr19

+

ATCGTGCATCCCTTTAGAGTGTT

AluSx-138854

chr2

-

CCAGGAGGTGGAGGTTGCAGT

AluSc-1117364

chr20

+

GGTGGATCACGAGGTCAGGAG

AluY-346134

chr5

-

GCCACTGCACTCCAGCCTGG


anti-intron


AluJo-118885

chr2

-

ACGCCTGTAATCCCAGCACTTT

AluSp-1004023

chr17

+

AGGCTGAGGTGGGAGGAT

AluSg-1022676

chr17

+

AGGTCAGGAGTTTGAGACCAGCCTGGCCAA

AluJo-135090

chr2

-

CCAGGAGGTGGAGGTTGCAGTG

AluSx-13507

chr1

-

CGAGACTAGCCTGGCCAACATGGTG

AluJo-576611

chr9

+

CTGCACTCCAGCCTGGGCA

AluSx-3296

chr1

-

GCCACTGCACTCCAGCCTGG

FLAM_C-1110015

chr19

-

TCAGGAGTTTGAGACCAGC


intron


AluJb-641

chr1

+

AGGCCTGTAATCCCAGCATTTT

AluSx-966613

chr16

-

AGGTGGAGGTTGCAGTGAG

AluSc-109651

chr2

-

ATGCCTGTAATCCCAGCACTTT

AluY-468716

chr7

+

CAGGAGGTGGAGGTTGCAGTGAGC

AluY-1159909

chr22

-

CCAGGAGGTGGAGGTTGCAGTG

AluSg-433754

chr7

+

CTTGAACCCAGGAGGCGGA

AluSg-974039

chr16

+

CTTTGGGAGGCTGAGGTGGG

AluSq/x-374792

chr6

-

GAGGTCAGGAGTTCGAGACT

AluJo-512070

chr8

+

GGAGGCCAAGGTGGGAGGAT

AluY-583205

chr9

-

TACTCGGGAGGCTGAGGCAGGAGAA


The sequences given represent the most abundant and longest miRNA sequences identified by high-throughput solexa sequencing. Asterisk indicates that the pre-miRNA can produce two mature miRNAs. The sequence of another miRNA is: CCCTCTAGATGGAAGCACTGTC.

Gu et al. BMC Genomics 2009 10:563   doi:10.1186/1471-2164-10-563

Open Data