Additional file 1:

Differentially-expressed genes during trout spermatogenesis. A searchable excel file containing normalized expression data (Log-2 transformed), annotations, and information about "Expression cluster" (A to I), "Tissue-profiling" ("Testis" and "Gonad") and "Expression conservation" with mouse ("Not detected", "Expressed" or "Correlated") for all differentially-expressed trout clones. Annotation information provided contains the "Clone Name", the annotation status ("None", "Not confident", "Confident"), the "EST Name" retained for annotation, the corresponding "BLAT Score", "Matching type" ("Exonic", "Intronic" or "Intergenic"), the "Overlapping length" (base pairs; if < 0 corresponds to the distance from the closest gene) and the confidence index "n", the "original matched Ensembl gene ID", the corresponding "Gene Symbol" and "Description", the "Fish ortholog Ensembl gene IDs" and "Fish ortholog descriptions", the "Non redundant ID" (Ensembl Gene ID of fish orthologs according to the following species availability: Gasteosteus aculeatus, Danio rerio, Oryzias latipes or Takifugu rubripes), the "Mammalian ortholog Ensembl gene IDs" (for human, mouse and rat), the "Mammalian ortholog gene symbols" and "Mammalian ortholog gene descriptions" and the corresponding mouse "Affymetrix ProbeSets".

Format: XLS Size: 6.8MB Download file

This file can be viewed with: Microsoft Excel Viewer

Additional file 2:

qPCR validation of microarray expression profiles. Total RNAs (2 μg, DNAse-treated) were submitted to reverse-transcription (RT) using random hexamer primers and MMLV reverse transcriptase for 2 hours at 37°C. Real-time PCR assays were performed on the StepOne™ Real-Time PCR System (Applied Biosystems) using 1:120 diluted RT products and the Fast SYBR^® Green Master Mix (Applied Biosystems). The amplification program consisted of an initial denaturation at 95°C for 20 seconds; 40 cycles of 95°C for 3 seconds, 60°C for 30 seconds; and a final progressive increase of temperature (From 65°C to 90°C, 0.5°C/second) for melting curve analysis. Cycle threshold (Ct) was manually setup and relative expression levels were normalised using an empirically designed reference gene, Rps15 (clone 1RT58B15_B_A08). Efficiency (95-105%) of PCR amplification was verified using serial dilutions of pooled RT products and the melting curve analysis was performed at the end of each real time PCR assay to control for specificity. Stage effects were determined using a non-parametric ANOVA (Kruskall-Wallis test). Forward (FW) and reverse (RV) primers were as follows: Amh (FW-GGGAATAACCATGCTATCCTGCTTAA; RV-CTCCACCACCTTGAGGTCCTCATAGT), Dmrt1 (FW-GGACACCTCCTACTACAACTTCTA; RV-GTTCGGCATCTGGTATTGTTGGT), Rps15 (FW-CCTGGGGGAGTTCTCTATCACCT; RV-GGGATGAAACGGGAAGAATGTGT), Slc26a4 (FW-CGGCACAAACATATACAGGAA; CCACCGTGACTCTCAATCGTTCT), Sox9a (FW-GTATTTCCAGTTCTTTCAGCCA; RV-TTTGCTATCTAGTTGTGTACGG), Sox9b (FW-AGCAGCAGTTGGATTCTAAAGTC; RV-ACACTTCTCCTGTTCGTCTG), Tbx1 (FW-CTTCGGCTACTAGTGCTGTGGAA; RV-CAACCTCCCAACCTTCTAACCTC). Roman numerals (I-VIII) indicate testicular developmental stages. GA and GB = type A and type B spermatogonia, repsectively; Sc = spermatocytes; St = spermatids. Log-2 transformed signal intensities from microarrays are also shown (Mean+-SD, left panels).

Format: PDF Size: 401KB Download file

This file can be viewed with: Adobe Acrobat Reader

Additional file 3:

Functional mining ("molecular function" and "cellular component") of trout spermatogenetic clusters. Over-represented "molecular function" and "cellular component" terms from the GeneOntology (GO) were identified in the 9 expression clusters shown in Figures 2 and 3 (A-I). Rectangles indicate the observed (left) and expected (right) numbers of genes bearing the corresponding GO term whereas the number of genes exhibiting this GO term on the entire microarray is given on the left. Only GO terms with a p-value ≤ 10^-6 and for which at least 3 non-redundant genes belonged to the cluster were considered as statistically-enriched. To avoid redundancy between closely related terms an Ontology Specific Information Rate (OSIR) cut-off ≥0.95 was selected. Numbers in bold indicate a statistical enrichment for a given GO term according to the scale bar.

Format: PDF Size: 816KB Download file

This file can be viewed with: Adobe Acrobat Reader

Additional file 4:

Enriched GO terms associated with trout spermatogenesis expression clusters. An Excel file containing all enriched GeneOntology terms ("Biological process", "Molecular function" and "Cellular process") for the 9 clusters shown in Figures 2 and 3. Only GO terms with a p-value ≤ 10^-6 and for which at least 3 non-redundant genes belonged to the cluster were considered as statistically-enriched, as previously mentioned. A low Ontology Specific Information Rate (OSIR) cut-off ≥0.05 was selected to allow redundancy between closely related terms.

Format: XLS Size: 157KB Download file

This file can be viewed with: Microsoft Excel Viewer

Additional file 5:

Functional mining of trout spermatogenetic, evolutionary conserved and testis-specific expression clusters. Enriched "biological process", "molecular function" and "cellular component" GeneOntology terms in "somatic" (Clusters A-D), "spermatogonial" (Clusters E and F) and "meiotic/pot-meiotic" (Clusters H-I) expression clusters as evidenced in 3 conditions: - genes differentially expressed during spematogenesis in trout; - subgroup of genes with correlated expression during mouse spermatogenesis; and - subgroup of genes exhibiting testis-specific expression. Rectangles indicate the observed (left) and expected (right) numbers of genes bearing the corresponding GO term whereas the number of genes exhibiting this GO term on the entire microarray is given on the left. Only GO terms with a p-value ≤ 10^-6 and for which at least 3 non-redundant genes belonged to the cluster were considered as statistically-enriched. To avoid redundancy between closely related terms an Ontology Specific Information Rate (OSIR) cut-off ≥0.95 was selected. Numbers in bold indicate a statistical enrichment for a given GO term according to the scale bar.

Format: PDF Size: 1.2MB Download file

This file can be viewed with: Adobe Acrobat Reader

Additional file 6:

Enriched GO terms in trout spermatogenetic, evolutionary conserved and testis-specific expression clusters. An Excel file containing all enriched GeneOntology terms ("biological process", "molecular function" and "cellular component") in "somatic" (Clusters A-D), "spermatogonial" (Clusters E and F) and "meiotic/pot-meiotic" (Clusters H-I) expression clusters as evidenced in 3 conditions: - genes differentially expressed during spematogenesis in trout; - subgroup of genes with correlated expression during mouse spermatogenesis; and - subgroup of genes exhibiting testis-specific expression. Only GO terms with a p-value ≤ 10^-6 and for which at least 3 non-redundant genes belonged to the cluster were considered as statistically-enriched, as previously mentioned. A low Ontology Specific Information Rate (OSIR) cut-off ≥0.05 was selected to allow redundancy between closely related terms.

Format: XLS Size: 196KB Download file

This file can be viewed with: Microsoft Excel Viewer

Additional file 7:

Tissue-specific gene expression in trout. Tissue-specific genes were identified on the basis of their high expression (average signal intensity ≥3^rd quartile) in at least one tissue (Testis, ovary, Liver, Muscle, Gill, or brain) and low or no expression (average signal intensity < median) in the 5 other tissues. Testis and Gonad specific genes are displayed according to 3 broad spermatogenesis expression clusters (i.e. somatic, spermatogonia and meiotic/post-meiotic). Log-2 transformed signal intensities are shown according to the scale bar.

Format: PDF Size: 1.6MB Download file

This file can be viewed with: Adobe Acrobat Reader

Additional file 8:

Trout clone annotation strategy. An ideogram presenting the annotation strategy for annotating a trout cDNA clone. BLAT alignments were performed on the fish species genomes available at the UCSC Genome Browser http://genome.ucsc.edu/ webcite. Annotation was performed using the Ensembl database http://www.ensembl.org/index.html webcite version 52.

Format: PDF Size: 462KB Download file

This file can be viewed with: Adobe Acrobat Reader