Table 1

Real-time qPCR analyses.

Genbank accessions, target

Primer sequence from 5' to 3'

PCR efficiency


CA366296, Src kinase associated phosphoprotein

F GAGGTGCTCCCAGAGGATGACA

R CAGTCCCACAAGCCCTGGTAGT

2.0

CA349943, C-type mannose-binding lectin

F TCCATTGCACTGGGCGATGC

R CACTGCTTCCACCTGAGCCTCA

1.667

CA361395, Leukocyte antigen CD37

F TGCTGAGACAAGCTTCTTCATGCC

R CGACATCGTAGCACTTCCACCAAT

1.696

CA364370, CD40

F CTGTAAACTGCACCCATACTGCGAC

R ATGGGCTGAGGCTTGTCTTGTTC

1.716

CU068239, Leukocyte cell-derived chemotaxin 2

F CTGTGTTGTCAGAGTGCGAGATGGT

R TACACACAATGTCCAGGCCCTGA

1.899

CA369467, 5-lipoxygenase activating protein

F TCTGAGTCATGCTGTCCGTAGTGGT

R CCTCCCTCTCTACCTTCGTTGCAAA

1.751

CA366162, Alpha-1-antiproteinase-like protein

F CCACAAGGCTGTGCTGAGCGTA

R TGAGCATGATGGTGTCTGGGAGAG

1.702

CA366315, YY1 transcription factor

F AAAGAAGACGACGCGCCCAG

R GGTGTGGAGATGCTTCCTCATCG

1.893

CF752495, Jun B

F CATCAGAAGTCGGCTCGCTGAA

R GGTGTCGGTGTGGTAGTGATGACA

1.743

CA341859, NFkB1

F CAGCGTCCTACCAGGCTAAAGAGAT

R GCTGTTCGATCCATCCGCACTAT

1.685

CA343143, NFkB inhibitor

F TGGTAACCTTGTGAAGGAGCTGGA

R GCTCAGCATGTTCTGTGGCTTCAT

2.00

CA361415, Jun C

F CAGCATGACACTGAACCTGGCTGA

R GCAAGTTTGAGGAGCTGCACATCC

2.00

CA345853, Plasma glutathione peroxidase precursor

F CCTTCCAGTACCTGGAGTTGAATGC

R CTCATGATTGTCTCCTGGCTCCTGT

1.904

CF753103, Glutathione peroxidase-gastrointestinal

F TGTACCTCAAGGAGAAGCTGCCGT

R ATTAAGGCCATGGGATCGTCGC

2.00

CA363120, Heme oxygenase

F TGGGTCTGACCTGGGTCCTCTCAT

R GAGGGTGGTTTCAGCGTTGAGC

1.664

CA368533, Vitronectin

F AAGCCCTTCGACGCCTTCCT

R CCTCTGATGCCCCACTTGTCGTAG

2.00

CA382259, Complement component 4 binding protein

F TGGTGGAGTATCAGTGTGACAGGCA

R GGTGGATTTGGCTCAAACTGTCCT

2.00

CA364804, Complement component 5-2

F AGAACTCTTCCGAGTTGGCATGGT

R AGTGATGCTGGGATCCATCTCTGA

1.952

CA366393, Mannan-binding lectin serine peptidase

F TCAGGTGCTGACGGAGAGGTCA

R GCACTCTGAATCCCTCTGGTAGGAG

1.971

CA387557, Complement component 1Q binding

F CGGTCTCTCTGGATGATGAGCCATA

R CCACATCCACACGACACAGGAGTA

2.00

CA376069, Cytochrome P450 3A27

F CCAACCTGCTGAACGGAATGAA

R AGAACTCCTTCACTTCGATGGCCT

2.00

CA378743, Fibronectin

F GCATGTCTGAGACGGGCTTCAA

R AGTCACATCGGAAGTGTCCACTGC

2.00

CA384134, G1/S-specific cyclin D2

F CATCAGACCACAGGAGTTGCTGGA

R AAGTCATTTGGAGTGACAGCCGC

2.00

CA363965, Liver bile salt export pump

F TACGACACCAACGTAGGTTCCCAGG

R GGATCTTAGGGTCGCGGATGATC

1.686

CA385588, CREB binding protein

F CTCCAGCCCAGGCCAACTCC

R GGCCAGGCAGGTGAGCTCCT

2.00

X64214, A. salmonicida genomic DNA fragment

F GTTTACCACGTAATCTGAATTGTTCTTTTC

R ATTGCTTATCGAGGCAGCCAAC

1.890

AJ427629, 18S rRNA

F GCCCTATCAACTTTCGATGGTAC

R TTTGGATGTGGTAGCCGTTTCTC

2.00


┼ákugor et al. BMC Genomics 2009 10:503   doi:10.1186/1471-2164-10-503

Open Data