Table 3

Primers used in qRT-PCR assays

Gene ID

Forward primer

Reverse primer


Tb10.26.0220

5' TCCAACCGATAACACGACAG 3'

5' CGATATGACCGACACGTCAC 3'

Tb927.7.7160

5' AGGCATCCATCGAGTACAGC 3'

5' TATCCTTCCGCAACACCTTC 3'

Tb10.6k15.3640

5' ACGGCCTCGTTGATACACTC 3'

5' CAACATTCCACCGACCATC 3'

Tb927.3.2710

5' GCAAGTCCATCACACAGGAG 3'

5' GAAGAGGCTACGGACACACC 3'

Tb927.1.4450

5' AGCAGCAGGTTATGGTGGAG 3'

5' ATACAACGATTCCGGTGAGC 3'

Tb10.389.0540

5' CCAGCCTTCTCAATCTCCAG 3'

5' GGCCACAGTTGGATAGCTTG 3'

Tb10.389.0650389.0650

5' ACGCTAGCACAACCAGAAGC 3'

5' GACCGACCAGGTCTTCTACG 3'


A list of all primers used to analyse gene expression profiles by qRT-PCR is shown with their associated Gene ID.

Kabani et al. BMC Genomics 2009 10:427   doi:10.1186/1471-2164-10-427

Open Data