Log on / register
Feedback | Support | My details
 
Open AccessResearch article

Two distinct groups of porcine enteropathogenic Escherichia coli strains of serogroup O45 are revealed by comparative genomic hybridization and virulence gene microarray

Guillaume Bruant1* email, Yongxiang Zhang2* email, Philippe Garneau1 email, Justin Wong2 email, Chad Laing2 email, John M Fairbrother1 email, Victor PJ Gannon2 email and Josée Harel1 email

Groupe de Recherche sur les Maladies Infectieuses du Porc, Faculté de médecine vétérinaire, Université de Montréal, 3200 rue Sicotte, Saint-Hyacinthe, Québec J2S 7C6, Canada

Laboratory for Foodborne Zoonoses, Public Health Agency of Canada, Lethbridge, Alberta, T1J 3Z4, Canada

author email corresponding author email* Contributed equally

BMC Genomics 2009, 10:402doi:10.1186/1471-2164-10-402

The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2164/10/402

Received: 23 April 2009
Accepted: 26 August 2009
Published: 26 August 2009

© 2009 Bruant et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

Porcine enteropathogenic Escherichia coli (PEPEC) strains of serogroup O45 cause post-weaning diarrhea and produce characteristic attaching and effacing (A/E) lesions. Most O45 PEPEC strains possess the locus of enterocyte effacement (LEE), encoding the virulence factors required for production of A/E lesions, and often possess the paa gene, which is thought to contribute to the early stages of PEPEC pathogenicity. In this study, nine O45 PEPEC strains and a rabbit enteropathogenic (REPEC) strain, known to produce A/E lesions in vivo, were characterized using an E. coli O157-E. coli K12 whole genome microarray and a virulence gene-specific microarray, and by PCR experiments.

Results

Based on their virulence gene profiles, the 10 strains were considered to be atypical EPEC. The differences in their genomes pointed to the identification of two distinct evolutionary groups of O45 PEPEC, Groups I and II, and provided evidence for a contribution of these genetic differences to their virulence in pigs. Group I included the REPEC strain and four O45 PEPEC strains known to induce severe A/E lesions in challenged pigs whereas Group II was composed of the five other O45 PEPEC strains, which induced less severe or no A/E lesions in challenged pigs. Significant differences between Groups I and II were found with respect to the presence or absence of 50 O-Islands (OIs) or S-loops and 13 K-islands (KIs) or K-loops, including the virulence-associated islands OI#1 (S-loop#1), OI#47 (S-loop#71), OI#57 (S-loop#85), OI#71 (S-loop#108), OI#115, OI#122, and OI#154 (S-loop#253).

Conclusion

We have genetically characterized a collection of O45 PEPEC strains and classified them into two distinct groups. The differences in their virulence gene and genomic island content may influence the pathogenicity of O45 PEPEC strains, and explain why Group I O45 PEPEC strains induced more severe A/E lesions in explants and challenged pigs than Group II strains.

Background

Escherichia coli of serogroup O45 may be isolated both in intestinal and extraintestinal sites, although they have been only sporadically described in the latter [1-3]. On the other hand, intestinal E. coli strains have been more frequently identified as belonging to this serogroup. Intestinal O45 E. coli strains have been isolated from animals and humans and have been classified as both enterotoxigenic (ETEC) and attaching and effacing (AEEC) E. coli, the latter including both enterohemorrhagic (EHEC) and enteropathogenic (EPEC) E. coli [4-6]. Serogroup O45 is particularly important among porcine EPEC (PEPEC) strains which cause post-weaning diarrhea (PWD) characterized by specific attaching and effacing (A/E) lesions [7-9]). Most O45 PEPEC strains possess the locus of enterocyte effacement (LEE) pathogenicity island, which contains virulence genes necessary for the production of A/E lesions. They also often possess the paa gene (for porcine A/E associated gene), which encodes a virulence factor involved in the A/E phenotype and is thought to contribute to the early stages of PEPEC pathogenicity [10]. These strains also have the ability to produce A/E lesions in experimentally inoculated newborn gnotobiotic piglets and in a homologous in vitro model using newborn piglet ileal explants, as well as to adhere to PK15 porcine kidney cells in vitro [10-14].

Genomic islands (GIs) such as LEE are regions of bacterial genomes that have been acquired by horizontal gene transfer and often contain blocks of genes that function together in specific processes. When the genomes of the two E. coli O157:H7 strains EDL933 and Sakai were compared with that of E. coli K12 strain MG1655, the GIs found to be present in strains EDL933 and Sakai but absent in strain MG1655 were named O-islands (OIs) and Sakai loops (S-loops), respectively. The GIs found to be present in E. coli K12 but absent from the two E. coli O157:H7 strains were named K-islands (KIs) and K-loops, respectively [15-17]. GIs related to the virulence of a pathogen are also referred to as pathogenicity islands (PAIs) [18]. In E. coli O157:H7 strain EDL933, several large OIs encode virulence or putative virulence factors. These OIs include OI#45 (S-loop#69) and OI#93 (S-loop#153) for Shiga toxin 2 and 1, respectively, OI#148 (S-loop#244) for LEE, and OI#57 (S-loop#85) for paa [16,17].

A recent microarray-based study has catalogued genomic alterations in a collection of E. coli O157:H7 strains, particularly in GIs, suggesting the existence of two dominant lineages, with characteristics that are unique to each of them [19]. Previous studies performed on various AEEC strains have also shown that, depending on their pathotype and host specificity, strains can show variations in their LEE sequences as well as in the site of insertion of LEE in the chromosome [14,20,21]. The purpose of the present study was to examine the genotypic differences, particularly in LEE sequences and chromosomal insertion sites, and in the presence or absence of non LEE-encoded virulence factors, such as Paa, among a collection of O45 PEPEC strains which have been previously shown to induce A/E lesions in pigs. In this study, we have characterized O45 PEPEC strains using a DNA-microarray designed specifically for detection of E. coli virulence genes [22] and compared their genomes using comparative genomic hybridization (CGH) and PCR. We identified two distinct groups of PEPEC O45 strains, between which there were significant variations in GI content.

Methods

Bacterial strains and preparation of genomic DNA

Nine O45 PEPEC strains, which were isolated at the Faculté de médecine vétérinaire, Saint-Hyacinthe, Québec, Canada, from pigs with PWD [13] were used for the microarray studies (Table 1). These strains were selected based, i) on their ability to produce or not A/E lesions in challenged pigs [13] and in an homologous ex vivo model using newborn piglet ileal explants (data not shown), ii) and on the severity of the A/E manifestation they produced [13] (Table 1). Because of its genetic and phenotypic similarities with the O45 PEPEC strains [23], the O103 rabbit EPEC (REPEC) strain E22, provided by Eric Oswald (INRA, Toulouse, France) [24,25], was included in the study. Five E. coli reference strains were used as controls in PCR experiments: the two O157:H7 E. coli strains EDL933 and Sakai, the K12 strain MG1655, the uropathogenic (UPEC) strain CFT073 and the REPEC strain RDEC-1.

Table 1. Characteristics of O45 PEPEC strains and REPEC strain E22 used in this study.

For DNA preparations, strains were grown overnight in 45 mL of Brain-Heart-Infusion (BHI) broth at 37°C. The cultures were centrifuged at 8000 rpm for 10 minutes and the pellet was dissolved in 15 mL of 10 mM NaCl, 20 mM Tris-HCl (pH 8.0), 1 mM EDTA, 100 μg/mL proteinase K and 0.5% SDS. This suspension was incubated at 50°C for 2 h and DNA was extracted with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1). Following centrifugation for 10 min at 8000 rpm, the upper phase was removed and precipitated by adding 0.1 volume of 3 M NaOAc (pH 5.2) and 2 volumes of 99% ethanol. The DNA precipitate was then spooled out of the solution using a sterile glass rod, washed with 70% ethanol, and dissolved in 5 mL of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) buffer.

E. coli DNA microarrays

For the whole genome microarray (named E. coli O157:H7 microarray), Corning Ultra-Gap II slides (Corning, Acton, MA) were spotted with the MWG E. coli O157:H7 array set (MWG Biotech). The MWG array set consists of 6167 50-mer oligonucleotides covering the whole genomes of E. coli K-12 strain MG1655 [15] and E. coli O157:H7 strains Sakai (RIMD 0509952) [16] and EDL933 (ATCC700927) [17].

The E. coli virulence microarray used in this study was derived from the one previously developed by Bruant et al. and included 315 70-mer oligonucleotides specific for 189 E. coli virulence or putative virulence genes or markers found in various intestinal and extraintestinal E. coli strains of all known pathotypes [22]. Probes were specific for genes encoding adhesins; toxins; bacteriocins; anti-aggregative factors; autotransporters; capsular, flagellar, and somatic antigens; hemolysins; invasins; iron acquisition systems or transport proteins; and outer membrane proteins, as well as other genes recently shown to be associated with virulence in E. coli. This microarray also detected genetic variants of particular genes, such as the intimin-encoding gene eae (variants alpha, alpha2, beta, beta2, delta, epsilon, epsilon2, eta, gamma, gamma2, iota, iota2, lambda, mu, nu, pi, xi, and zeta), espA (variants espA1, espA2, and espA3), espB (variants espB1, espB2, and espB3), and tir (variants tir-1, tir-2, and tir-3) from the LEE. Oligonucleotides specific for three variants of the major fimbrial subunit of the long polar fimbria (LPF)-encoding gene lpfA were also included. These were based on sequences from the lpfA genes of EPEC strains of serogroup O113 (lpfAO113), OI#141 from E. coli of serotype O157:H7 (lpfA1), and REPEC strains and E. coli of serogroup O26 (lpfAR141).

Microarray hybridizations

Prior to E. coli O157:H7 microarray hybridization, each array was pre-hybridized at 50°C in a solution of 5 × SSC, 0.1% SDS and 0.1% BSA for 1 h. Following this step, arrays were washed completely in dH2O, rinsed with isopropanol, and then centrifuged and dried. For hybridization, 5 μg of test genomic DNA were digested with EcoRV and PstI restriction enzymes, 3 μg of which were labeled with ULYSIS Alexa Fluor 647 dye (Invitrogen, Burlington, ON). Genomic DNA from strains MG1655, Sakai and EDL933 was digested in an analogous fashion, and 1 μg of the preparation from each strain was combined and labeled with Alexa Fluor 546 dye (Invitrogen, Burlington, ON). This labeled genomic DNA mixture was then used as a reference for all hybridizations. Unincorporated dye was removed using Qiaquick PCR purification kits (Qiagen, Mississauga, ON), according to the manufacturer's instructions, and DNA was eluted in 30 μl of 0.1 × TE buffer. Labeled DNA was vacuum-dried and resuspended in 20 μl of dH2O. A 70 μl hybridization solution consisting of 30% formamide, 5 × SSC, 0.1% SDS, 0.1 mg/ml sonicated Salmon sperm DNA, and equal amounts of test and reference labeled DNAs, each containing at least 30 pmol of incorporated dye, was denatured at 95°C for 5 min and briefly centrifuged to collect all the contents. DNA preparations were then hybridized overnight (16 h) at 42°C. After hybridization, arrays were washed according to the modified Corning method (Corning). Arrays were then scanned with a GenePix 4000B scanner (Axon Instruments, Redwood City, CA) and processed using GenePix Pro 5.0. Two slides were hybridized per strain with a dye-swap repeat per slide.

Hybridizations on E. coli virulence microarrays were performed as described previously [22]. Arrays were scanned with a ScanArray® Lite fluorescent microarray analysis system (Canberra-Packard Canada, Montreal, Quebec) and acquisition and quantification of fluorescent spot intensities were performed using the ScanArray Express® software version 2.1 (Perkin-Elmer, Foster City, CA, USA).

Microarray data analysis

Data obtained from E. coli O157:H7 microarrays were normalized using the Ratio-based and Lowess methods in Acuity 3.1 (Axon instruments) before analysis. The normalized data for all strains were converted into log2 (Fluor 647/Fluor 546) in Acuity 3.1 and subsequently analyzed in Microsoft Excel. Control, blank, and test spots with a mean intensity below that of the mean of all negative controls were removed from the analysis. The arithmetic mean of the remaining spots across the four duplicates was calculated to construct the dataset. GACK (for Genomotyping Analysis by Charles Kim) [26], was used to generate a cut-off value determining the presence or absence of genes, and a dendrogam using the Euclidean distance metric with average linkage was created with tMEV v4.1 [27].

For the data obtained from E. coli virulence microarrays, the local background was subtracted from the recorded spot intensities. The median value of each set of triplicate spotted oligonucleotides was then compared to the median value of the negative control spots present on the array. Oligonucleotides with a signal-to-noise fluorescence ratio greater than 2.0 were considered as positive.

Microarray data accession number

The microarray data have been deposited in NCBI's Gene Expression Omnibus (GEO accession number GSE17036) http://www.ncbi.nlm.nih.gov/projects/geo/ webcite.

PCR experiments

PCR experiments were performed for the nine O45 PEPEC strains and the REPEC strain E22 to determine the localization in their chromosome of the LEE and of the OI#122, as well as the integrity of the OI#122 and of the secondary type III secretion system gene cluster designated ETT2 (for E. coli type III secretion 2). All PCR experiments were performed as described in previous studies carried out on the LEE, OI#122 and ETT2 gene clusters (Additional file 1: Table S1 [21,23,28-31]).

Additional file 1. Table S1. Primers and E. coli control strains used for PCR experiments.

Format: PDF Size: 22KB Download file

This file can be viewed with: Adobe Acrobat Reader

PCR experiments were also performed for nleA and nleC genes. The pairs of primers used were nleA-F (ACCGCAATCCGAATTACCTC) – nleA-R (TCCATTGCGCGTATATCAGC) and ECs1812F (CTGTCCAACAGGGATAC) – ECs1812R (CCGCAATCCGAATTACC) for nleA, and nleC-F (AAGTGTAATACGCGCCGTCC) – nleC-R (ATCAGGACTCGCCTCATATC) and ECs0847F (CCCATTGCTCCTAATCG) – ECs0847R (CAGCGGAATACTCTGTG) for nleC. The conditions for amplifications were an initial denaturation of 95°C for 5 min, followed by 30 cycles of 95°C for 30 s; 55°C for 30 s; 72°C for 80 s and a final elongation of 72°C for 10 min.

Results

Characterization of O45 PEPEC strains using the E. coli virulence microarray

All O45 PEPEC strains and the REPEC strain E22 were characterized using the E. coli virulence microarray described previously, which includes probes targeting virulence genes generally found in AEEC but also virulence genes from the other E. coli virotypes [22]. All strains possessed their own specific virulence gene profile but were all classified as atypical EPEC (Additional file 2: Table S2 [32]). They all possessed the LEE genes and shared the same LEE profile: eae(β) espA group I – espB group III – tir group I. In addition, each strain lacked the Shiga toxin 2 encoding genes stx2A and stx2B, as well as the bundle forming pili (BFP) encoding gene bfpA and the E. coli adherence factor (EAF) virulence plasmid marker eaf. Remarkably, all O45 PEPEC strains and REPEC strain E22, although stx1A-negative, gave a positive hybridization for the stx1B gene, which encodes the B subunit of EHEC Shiga-like toxin 1 and which is generally absent in EPEC strains. However, the presence of the stx1B gene was not confirmed in PCR experiments (data not shown).

Additional file 2. Table S2. Presence of virulence genes in O45 PEPEC strains and REPEC strain E22 as determined by E. coli virulence microarray.

Format: PDF Size: 35KB Download file

This file can be viewed with: Adobe Acrobat Reader

The E. coli strains could be classified into two distinct groups according to their virulence gene pattern (Additional file 2: Table S2 [32]). Group I included the four PEPEC strains ECL1001, ECL2004, ECL2017, and ECL2033, and REPEC strain E22. Group II included the five other PEPEC strains ECL2019, ECL2020, ECL2027, ECL2076, and ECL2078. Results obtained with the E. coli virulence microarray identified 19 virulence genes that showed a non-random distribution between Group I and Group II strains (Additional file 2: Table S2 [32]). Genes b1121 (encoding a hypothetical protein YcfZ), set (encoding a probable enterotoxin, also named ent), tspE4.C2 (an anonymous fragment), efa1 (encoding the EHEC factor for adherence Efa1), and paa were present in all Group I strains, including REPEC strain E22, but absent from all Group II strains. The temperature sensitive hemagglutinin encoding gene tsh, the yersiniabactin-related genes fyuA, irp1 and irp2, as well as the PAI-associated gene malX were present in all O45 PEPEC strains from Group I but in neither REPEC strain E22 nor Group II strains. The heat-stable enterotoxin encoding gene astA was present in all O45 PEPEC Group I strains and in Group II strain ECL2020 but absent from all other Group II strains and REPEC strain E22.

The genes aidaI (encoding the Adhesin Involved in E. coli Diffuse Adherence), chuA (an iron related gene), ECs1282 (encoding a probable filamentous hemagglutinin-like protein), rtx (encoding a putative RTX family exoprotein), and yjaA (encoding a hypothetical protein) were present in all Group II strains but absent from Group I strains, including REPEC strain E22. The gene fepC (encoding a ferric enterobactin transport ATP-binding protein) was present in three Group II strains (ECL2019, ECL2078 and ECL2027) but absent from all other strains.

In addition, Group I and Group II strains possessed different variants of the fliC (encoding the flagellin major subunit) and lpfA genes. O45 PEPEC strains from Group I, including REPEC strain E22, possessed the fliC variant flmA54, whereas Group II strains possessed the fliC gene. Group I strains also possessed the lpfAO113 and lpfAR141 variants, whereas REPEC strain E22 only possessed the lpfAR141 variant, and Group II strains possessed the lpfA1 variant.

Previous phylogenetic analyses have shown that most E. coli strains belonged to the four main phylogenetic groups A, B1, B2, and D. Whereas extraintestinal E. coli strains belong mainly to groups B2 and D, most commensal and diarrheogenic strains belong to group A and group B1 [33]. Determination of the phylogenetic groups of the O45 PEPEC strains and REPEC strain E22 was based on the presence or absence of the two genes chuA and yjaA, and the DNA fragment tspE4.C2, as described by Clermont et al. [32]. All Group I strains including REPEC strain E22 were classified in phylogenetic group B1 and all Group II strains were classified in phylogenetic group B2.

CGH-Genomotyping of PEPEC strains

The CGH-based genomotyping analysis of the nine O45 PEPEC strains and the REPEC strain E22 led to their classification into two distinct groups in the same distribution as observed by the E. coli virulence microarray. A dendrogram based on the analysis of the CGH data for O45 PEPEC strains and REPEC strain E22, as well as for the two O157:H7 strains Sakai and EDL933 is presented in Figure 1. The distribution of GIs in O45 PEPEC strains and REPEC strain E22 was investigated by analysis of the CGH data. Since the microarray used for CGH was not an EPEC-specific microarray and was composed of oligonucleotide probes specific for genome sequences of O157:H7 EHEC and K12 strains, it was not possible to investigate all the GIs in O45 PEPEC strains. The divergences in GIs observed by CGH could thus indicate either the absence of particular genes or the presence of different variants of these genes. As shown in Table 2, 63 GIs (islands or loops) were found to be significantly different between Group I and Group II strains. Among these 63 GIs, 13 were KIs or K-loops and 50 were OIs or S-loops. Twenty GIs were present in Group I strains but absent in Group II strains, including OI#57 (S-loop#85), which contains the paa gene, and the two virulence related GIs, OI#71 (S-loop#108) [34] and OI#122 [35,36]. On the other hand, 33 GIs were absent in Group I strains but present in Group II strains, including OI#1 (S-loop#1), OI#47 (S-loop#71) and OI#154 (S-loop#253), which contain fimbriae related genes. KI#60 (K-loop#97), which was absent in all Group II strains, was present in the four O45 PEPEC strains from Group I but not in REPEC strain E22. Interestingly, for seven GIs, more than half of the ORFs in each island were present in all Group I strains whereas these GIs were absent in all Group II strains. Conversely, for two GIs, more than half of the ORFs in each island were present in Group II strains whereas these GIs were absent in Group I strains.

thumbnailFigure 1. CGH-based genomotyping of the O45 PEPEC strains. The nine O45 PEPEC strains and the REPEC strain E22 were classified in two distinct groups by CGH-based genomotyping, in the same distribution as observed by the E. coli virulence microarray (Groups I and II). The O157:H7 strains Sakai and EDL933 were used as controls. The tree was constructed with tMEV v4.1 and viewed in SplitsTree 4.1 [27] by using the Euclidean distance, average linkage algorithm and 1,000 bootstrap replicates. Bootstrap confidence values are indicated at the nodes.

Table 2. Genomic islands comparison between two genotype groups of E. coli O45 strains.

In addition to the 63 GIs found to be significantly different between Group I and Group II strains, 26 other GIs were conserved in both Groups (Table 3). Eight of these GIs were KIs or K-loops and 18 were OIs or S-loops.

Table 3. Conserved genomic islands identified by CGH in O45 PEPEC strains.

Finally, analysis of the E. coli O157:H7 microarray data indicated that the Shiga toxin encoding genes stx1 and stx2 could not be detected in any of the O45 PEPEC strains or in the REPEC strain E22, and that similarly, all strains were lacking both the tccp (ECs2715/Z3072) and tccp2 (ECs1126/Z1385) genes, which encode E. coli O157:H7 type III effector proteins that couple the intimin receptor Tir to the actin-cytoskeleton, and trigger actin polymerization [37-40].

Analysis of LEE by the E. coli O157:H7 microarray

Thirty of the 41 genes on LEE (OI#148/S-loop#244) were found to be conserved among the O45 PEPEC strains, REPEC strain E22, and the two O157:H7 strains EDL933 and Sakai (Table 4). These included the effector-encoding genes espA, espF and espG, the regulator ler, and most of the genes of the type III secretion pathway such as sepL, escD, cesT, escN, escV, sepD, escC, cesD, escU, escT, escS, and escR. For the 11 remaining genes on LEE, no hybridization was observed in the O45 PEPEC strains and REPEC strain E22, possibly reflecting genetic divergences between these strains and the O157:H7 representative strains EDL933 and Sakai. These genes were the effector-encoding genes espB, espD, and espH, intimin and the translocated intimin receptor-encoding genes eae and tir, the genes of the type III secretion pathway sepQ, sepZ, and escJ, and the genes map, mpc (for multiple point controller) and Z5117.

Table 4. Divergence in the LEE genes among O45 PEPEC strains and REPEC strain E22.

Localization of LEE and OI#122

The LEE of AEEC strains is often inserted in the vicinity of the tRNA loci selC or pheU. Since it has been previously reported that the site of insertion of LEE in PEPEC strains could be either in selC or in pheU [23], the O45 PEPEC strains in our study and REPEC strain E22 were examined by PCR using primers specific for these two genes and for LEE extremities (Additional file 1: Table S1 [21,23,28-31]). The LEE was found to be inserted into the tRNA pheU locus in all examined strains. Remarkably, an amplicon of 500 bp longer than the expected size was also obtained with primers specific for LEE extremities and selC for strains ECL2033 and ECL2020 (Additional file 3: Table S3 [22]).

Additional file 3. Table S3. Localization of the LEE and OI#122 in O45 PEPEC strains and REPEC strain E22.

Format: PDF Size: 17KB Download file

This file can be viewed with: Adobe Acrobat Reader

Similarly, the localization and integrity of OI#122 was determined by PCR using primers described previously (Additional file 1: Table S1 [21,23,28-31]). All Group I strains possessed this GI and were positive for the four genes tested; efa1, ent, nleB, and nleE, with the latter two encoding non-LEE virulence factors. OI#122 was found to be inserted into the tRNA pheU locus in strain ECL2033 and into the tRNA pheV locus in strains ECL1001 and ECL2004. The site of insertion of this GI was not determined for strain ECL2017 or for REPEC strain E22. All Group II strains lacked OI#122 (Additional file 3: Table S3 [22]).

nle genes in O45 PEPEC strains

The E. coli O157:H7 microarray used in our CGH studies contains oligonucleotide probes specific for genes encoding non-LEE factors which have previously been associated with the pathogenicity of AEEC strains [34,41]. The nleA and nleC genes were present in all O45 PEPEC strains and REPEC strain E22 as determined by the O157:H7 microarray (Table 5). Nevertheless, PCR analysis using two different primer sets for each gene (Additional file 1: Table S1 [21,23,28-31]) revealed amplicons of various sizes in the different strains, showing that the nleA and nleC genes in Group I were different from those in Group II (data not shown).

Table 5. Distribution of nle genes among O45 PEPEC strains and REPEC strain E22.

Sixteen other nle genes showed non-random distributions between Group I and Group II strains (Table 5). The five genes espY3, espX2, espR1, espL3' (Z5199/ECs4642), and espL3' (Z5200/ECs4643) were absent in all Group I strains but present in Group II strains. On the other hand, the five genes espX7, espK, espL2, nleB1, and nleE were present in all Group I strains but absent in Group II strains. The four genes nleG2-1', espO1-2, nleG, and nleG9' were present in all Group I strains with the exception of REPEC strain E22, and absent in Group II strains. The gene nleB2-1 was present in all Group II strains and also in REPEC strain E22 but absent in the other Group I strains. The gene nleD was present in only two Group I strains, ECL2004 and ECL2033, and absent in all the other strains, including REPEC strain E22.

Two additional nle genes, nleF and nleH, were present in all O45 PEPEC strains. nleH, but not nleF, was also present in REPEC strain E22 (Table 5).

Distribution of ETT2 genes

OI#115, initially described in E. coli of serotype O157:H7 and present in other EPEC and EHEC strains from animals and humans, contains the secondary type III secretion system gene cluster ETT2 [31,42,43]. CGH data analysis revealed that all Group II strains had the entire ETT2 locus comprising 36 genes, with the exception of strain ECL2019, which lacked most of this GI (Additional file 4: Table S4 [16]).

Additional file 4. Table S4. Distribution of ETT2 genes in O45 PEPEC strains and REPEC strain E22.

Format: PDF Size: 16KB Download file

This file can be viewed with: Adobe Acrobat Reader

In contrast, Group I strains possessed only a partially intact locus and the occurrence of the ETT2 genes was highly variable. Among the 36 ETT2 genes, strain ECL2033 possessed only 21, strain ECL2004 possessed 20, strain ECL1001 possessed 17, and strain ECL2017 possessed 15. Finally, REPEC strain E22 possessed 21 genes of this GI. These results were confirmed by PCR as described previously [31], with primers specific for different regions of the ETT2 gene cluster (Additional file 1: Table S1 [21,23,28-31]).

Genes required for intestinal colonization in the bovine

Previous studies have identified several genes required for EHEC intestinal colonization of the bovine [44,45]. Microarray analysis in our study revealed that 13 genes associated with colonization of either E. coli O157:H7 or E. coli O26:H- in the bovine were associated with either Group I or Group II strains (Additional file 5: Table S5). Seven genes were present in Group I but not in Group II strains, with the exception of REPEC strain E22 which did not possess the gene Z6010 (ECs1824). In contrast, six other genes were present in Group II but not in Group I strains, with the exception of REPEC strain E22 which possessed the gene Z1526 (ECs1270). These results were confirmed by PCR using primers designed for each gene (data not shown).

Additional file 5. Table S5. Divergence of genes related to intestinal colonization in bovine and calves as determined by CGH.

Format: PDF Size: 16KB Download file

This file can be viewed with: Adobe Acrobat Reader

Discussion

In this study, we investigated the genetic relationships among PEPEC strains of serogroup O45 and catalogued genomic alterations unique to these strains by using both a virulence gene-specific microarray and a whole genome microarray. The 045 PEPEC strains in this study have been previously characterized for their capacity to induce A/E lesions in both explants and challenged pigs, and were grouped according to the severity of the A/E manifestation they produced [13]. Based on their virulence gene content as determined by the E. coli virulence microarray, O45 PEPEC strains and REPEC strain E22 displayed significant differences from typical EPEC and could be regarded as atypical EPEC, that are defined as LEE-positive E. coli lacking stx1 and stx2 genes, as well as the EAF virulence plasmid which encodes the EPEC adhesin BFP [46,47]. In addition, all O45 PEPEC strains and REPEC strain E22 unexpectedly hybridized with the stxB1 probe of the E. coli virulence microarray, as was also observed for some atypical EPEC strains isolated from children with diarrhea in a recent study in Norway [35,48]. Due to the absence of hybridization with the corresponding stxA1 probe and the negative PCR results obtained with stxB1 sequence specific primers [35,48], we therefore concluded that the gene sequences detected by the stxB1 hybridization probe did not represent a complete stxB gene but rather a possible truncated form of this gene.

As observed for other atypical EPEC strains, O45 PEPEC strains and REPEC strain E22 also displayed a relatively high heterogeneity in their virulence gene profiles [35,49]. Based on their virulence gene content, they could be divided into two distinct groups, Groups I and II. It has been argued that atypical EPEC strains could have arisen from E. coli strains of different pathotypes which acquired the LEE by horizontal gene transfer or from certain typical EPEC strains that have lost the EAF plasmid [49]. Trabulsi et al. have also observed that some atypical EPEC strains are genetically closer to EHEC strains of serotype O157:H7 than to typical EPEC [50]. Several virulence genes showed a non-random distribution between Group I and Group II strains. Group I strains thus possessed several virulence-related genes which were absent in Group II strains. Group I-specific genes included paa (which contributes to A/E lesion formation in PEPEC strains [10]) and OI#122 genes efa1 (which plays an important role in intestinal colonization by EHEC strains in cattle [51]) and set (which encodes a putative enterotoxin highly similar to the enterotoxin ShET2 of Shigella flexneri). Genes associated with other pathotypes were also found. The gene tsh, encoding a hemagglutinin which may be a virulence factor of avian extraintestinal E. coli [52], the pathogenicity island marker malX, related to virulence in extraintestinal E. coli [53] and the yersiniabactin-related genes fyuA, irp1 and irp2, implicated in the ferric uptake system, were also Group I-specific. In contrast, Group II strains possessed only a few additional virulence-related genes when compared with Group I strains. These included aidaI, which encodes a protein involved in the adherence of EPEC [54], and iron uptake-related genes chuA and fepC. Finally, Group I and Group II strains also possessed different variants of the long polar fimbriae encoding gene lpfA. A recent study has shown that the lpfAO113 variant, found in Group I strains in our study, was found significantly more frequently in atypical EPEC strains associated with cases of diarrhea than in strains isolated from healthy individuals [35].

It is interesting to note that analysis by CGH using a whole genome E. coli microarray, representing two lineage I, human outbreak-related E. coli O157:H7 strains and one non-pathogenic E. coli K12 strain, resulted in the distribution of the O45 PEPEC strains into the same two groups (Groups I and II), observed for the E. coli virulence microarray. This genetic-based grouping, principally reflecting the virulence gene content of the strains, was also compatible with the grouping based on their A/E activity [13]. The O45 PEPEC strains of Group I all induced severe A/E lesions whereas those of Group II induced less severe or no A/E lesions in both pig ileal explants and challenged pigs. REPEC strain E22 was placed into Group I but was genetically distant from the four O45 PEPEC strains belonging to this group. These strains showed a relatively high level of heterogeneity in their virulence gene profiles.

In addition to the variations in particular virulence genes, significant variations in GIs were also observed between Group I and II strains. We observed that several virulence-related OIs were present only in Group I strains. These included OI#57 (S-loop#85), which contains the paa gene; OI#71 (S-loop#108), which contains the non-LEE encoded factor gene nleA, previously shown to be associated with the pathogenicity of AEEC strains [34]; and OI#122 which contains the two non-LEE encoded factor genes nleB and nleE and virulence genes efa1 and set. Interestingly, these OIs have also been shown to be more prevalent in STEC strains associated with outbreaks and severe disease [35,36]. On the other hand, certain OIs were only present in Group II strains. These include OI#1 (S-loop#1), containing genes encoding putative fimbrial chaperone proteins; OI#47 (S-loop#71), containing a fimbrial operon and genes encoding several additional putative virulence factors in E. coli of serogroup O157 [55]; and OI#154 (S-loop#253), containing genes encoding putative type 1 fimbrial proteins. Finally, OI#115 was highly divergent between Group I and Group II strains. This OI contains the secondary type III secretion system gene cluster ETT2, which resembles the SPI-1-encoded type III secretion system from Salmonella enterica and has been previously characterized in O157:H7 E. coli strains [16,17]. It has been recently shown that ETT2 influences the secretion of proteins encoded by the LEE and also modulates adhesion to human intestinal cells [56]. Most Group II strains (4/5) possessed the entire ETT2. However, Group II strain ECL2019 lacked most of the entire cluster (only four genes were found to be present) and was one of the two strains which did not induce A/E lesions in explants or in challenged pigs. Group I strains, including REPEC strain E22, have only a partial ETT2 gene cluster, possessing from 15 to 21 genes of the 36 in the intact cluster. The substantial variations observed for this cluster are consistent with the findings of previous studies, that while the ETT2 gene cluster was present in most of the E. coli strains tested, it contained numerous inactivating mutations [31,42,43].

In contrast to the heterogeneity of their virulence gene content and GI distribution, O45 PEPEC strains and REPEC strain E22 showed a high level of homogeneity in their LEE sequences and site of insertion. In all strains, the LEE was inserted into the tRNA pheU gene and no significant divergence between Group I and Group II strains was observed for the LEE genes. In addition, all O45 PEPEC strains and REPEC strain E22 shared the same profile for the intimin encoding gene eae, its translocated receptor tir and the effector encoding genes espA and espB, as shown by the E. coli virulence microarray. All strains possessed the beta variant of the intimin encoding gene, being the most widespread among the intestinal EPEC strains of different animal species [57,58]. However, Group I and Group II strains from our study all belonged to the phylogenetic groups B1 and B2 whereas Ishii et al. have shown that most EPEC strains possessing the intimin subtype beta belong to phylogenetic groups A and B1 [59].

Finally, we have also observed numerous disparities in the distribution of non-LEE encoded genes. Several nle genes were only present in Group I strains whereas others were only found in Group II strains. In addition, Group I and Group II strains possessed two different variants of the genes nleA and nleC. This variation in the distribution of nle genes may influence the pathogenicity of the strains and the type of A/E lesions they produce, since many studies have shown the importance of non-LEE encoded factors in the A/E phenotype [34,41,60,61].

Conclusion

We have genetically characterized a collection of O45 PEPEC strains using E. coli O157-E. coli K12 whole genome and virulence gene-specific E. coli microarrays. We have shown that the strains, although showing some heterogeneity, could be classified into two groups, based on their virulence gene and GI content. These differences in their virulence gene content may influence the pathogenicity of O45 PEPEC strains, and explain why Group I O45 PEPEC strains induced more severe A/E lesions in explants and challenged pigs than Group II strains [13,14].

Authors' contributions

GB and YZ both contributed equally to the manuscript: they were involved in the conception and design of the study, in the analysis and interpretation of the microarray data, and in drafting and revising the manuscript. PG, JW, and CL were involved in the acquisition of the microarray data and in revising the manuscript. JMF was involved in revising the manuscript critically for important intellectual content. VPJG and JH were involved in the conception and design of the study, and revising the manuscript critically for important intellectual content. All authors read and approved the final manuscript.

Acknowledgements

Clarisse Desautels, from the Reference Laboratory for E. coli, Faculté de médecine vétérinaire, Université de Montréal, is greatly acknowledged for her information and her help regarding the collection of O45 PEPEC strains. This work was supported in part by the Natural Sciences and Engineering Research Council of Canada (NSERC) (STPGP 364950), and by the Fond Québécois de la Recherche sur la Nature et les Technologies (FQRNT) (PR-121927). G.B. was supported by a scholarship "Michel Saucier" from Fondation Canadienne Louis Pasteur (FCLP).

References

  1. Ott M, Bender L, Blum G, Schmittroth M, Achtman M, Tschape H, Hacker J: Virulence patterns and long-range genetic mapping of extraintestinal Escherichia coli K1, K5, and K100 isolates: use of pulsed-field gel electrophoresis.

    Infect Immun 1991, 59(8):2664-2672. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  2. Plainvert C, Bidet P, Peigne C, Barbe V, Medigue C, Denamur E, Bingen E, Bonacorsi S: A new O-antigen gene cluster has a key role in the virulence of the Escherichia coli meningitis clone O45:K1:H7.

    J Bacteriol 2007, 189(23):8528-8536. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  3. Wullenweber M, Beutin L, Zimmermann S, Jonas C: Influence of some bacterial and host factors on colonization and invasiveness of Escherichia coli K1 in neonatal rats.

    Infect Immun 1993, 61(5):2138-2144. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  4. Blanco J, Blanco M, Garabal JI, Gonzalez EA: Enterotoxins, colonization factors and serotypes of enterotoxigenic Escherichia coli from humans and animals.

    Microbiologia 1991, 7(2):57-73. PubMed Abstract OpenURL

  5. Nagy B, Fekete PZ: Enterotoxigenic Escherichia coli (ETEC) in farm animals.

    Vet Res 1999, 30(2–3):259-284. PubMed Abstract OpenURL

  6. Toth I, Karcagi V, Nagy B, Gado I, Milch H: Examination of verocytotoxin producing capacity and determination of the presence of Shiga-like toxin genes in human Escherichia coli isolates.

    Acta Microbiol Immunol Hung 1994, 41(3):259-264. PubMed Abstract OpenURL

  7. Frydendahl K: Prevalence of serogroups and virulence genes in Escherichia coli associated with postweaning diarrhoea and edema disease in pigs and a comparison of diagnostic approaches.

    Vet Microbiol 2002, 85(2):169-182. PubMed Abstract | Publisher Full Text OpenURL

  8. Harel J, Lapointe H, Fallara A, Lortie LA, Bigras-Poulin M, Lariviere S, Fairbrother JM: Detection of genes for fimbrial antigens and enterotoxins associated with Escherichia coli serogroups isolated from pigs with diarrhea.

    J Clin Microbiol 1991, 29(4):745-752. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  9. Helie P, Morin M, Jacques M, Fairbrother JM: Experimental infection of newborn pigs with an attaching and effacing Escherichia coli O45:K"E65" strain.

    Infect Immun 1991, 59(3):814-821. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  10. Batisson I, Guimond MP, Girard F, An H, Zhu C, Oswald E, Fairbrother JM, Jacques M, Harel J: Characterization of the novel factor paa involved in the early steps of the adhesion mechanism of attaching and effacing Escherichia coli.

    Infect Immun 2003, 71(8):4516-4525. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  11. Girard F, Batisson I, Frankel GM, Harel J, Fairbrother JM: Interaction of enteropathogenic and Shiga toxin-producing Escherichia coli and porcine intestinal mucosa: role of intimin and Tir in adherence.

    Infect Immun 2005, 73(9):6005-6016. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  12. Girard F, Oswald IP, Taranu I, Helie P, Appleyard GD, Harel J, Fairbrother JM: Host immune status influences the development of attaching and effacing lesions in weaned pigs.

    Infect Immun 2005, 73(9):5514-5523. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  13. Zhu C, Harel J, Jacques M, Desautels C, Donnenberg MS, Beaudry M, Fairbrother JM: Virulence properties and attaching-effacing activity of Escherichia coli O45 from swine postweaning diarrhea.

    Infect Immun 1994, 62(10):4153-4159. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  14. Zhu C, Harel J, Jacques M, Fairbrother JM: Interaction with pig ileal explants of Escherichia coli O45 isolates from swine with postweaning diarrhea.

    Can J Vet Res 1995, 59(2):118-123. PubMed Abstract | PubMed Central Full Text OpenURL

  15. Blattner FR, Plunkett G 3rd, Bloch CA, Perna NT, Burland V, Riley M, Collado-Vides J, Glasner JD, Rode CK, Mayhew GF, Gregor J, Davis NW, Kirkpatrick HA, Goeden MA, Rose DJ, Mau B, Shao Y: The complete genome sequence of Escherichia coli K-12.

    Science 1997, 277(5331):1453-1474. PubMed Abstract | Publisher Full Text OpenURL

  16. Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K, Yokoyama K, Han CG, Ohtsubo E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa H: Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12.

    DNA Res 2001, 8(1):11-22. PubMed Abstract | Publisher Full Text OpenURL

  17. Perna NT, Plunkett G 3rd, Burland V, Mau B, Glasner JD, Rose DJ, Mayhew GF, Evans PS, Gregor J, Kirkpatrick HA, Posfai G, Hackett J, Klink S, Boutin A, Shao Y, Miller L, Grotbeck EJ, Davis NW, Lim A, Dimalanta ET, Potamousis KD, Apodaca J, Anantharaman TS, Lin J, Yen G, Schwartz DC, Welch RA, Blattner FR: Genome sequence of enterohaemorrhagic Escherichia coli O157:H7.

    Nature 2001, 409(6819):529-533. PubMed Abstract | Publisher Full Text OpenURL

  18. Kaper JB, Mellies JL, Nataro JP: Pathogenicity islands and other mobile genetic elements of diarrheagenic E. coli. Washington D. C.: ASM Press; 1999.

  19. Zhang Y, Laing C, Steele M, Ziebell K, Johnson R, Benson AK, Taboada E, Gannon VP: Genome evolution in major Escherichia coli O157:H7 lineages.

    BMC Genomics 2007, 8:121. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  20. Elliott SJ, Wainwright LA, McDaniel TK, Jarvis KG, Deng YK, Lai LC, McNamara BP, Donnenberg MS, Kaper JB: The complete sequence of the locus of enterocyte effacement (LEE) from enteropathogenic Escherichia coli E2348/69.

    Mol Microbiol 1998, 28(1):1-4. PubMed Abstract | Publisher Full Text OpenURL

  21. Sperandio V, Kaper JB, Bortolini MR, Neves BC, Keller R, Trabulsi LR: Characterization of the locus of enterocyte effacement (LEE) in different enteropathogenic Escherichia coli (EPEC) and Shiga-toxin producing Escherichia coli (STEC) serotypes.

    FEMS Microbiol Lett 1998, 164(1):133-139. PubMed Abstract | Publisher Full Text OpenURL

  22. Bruant G, Maynard C, Bekal S, Gaucher I, Masson L, Brousseau R, Harel J: Development and validation of an oligonucleotide microarray for detection of multiple virulence and antimicrobial resistance genes in Escherichia coli.

    Appl Environ Microbiol 2006, 72(5):3780-3784. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  23. An H, Fairbrother JM, Desautels C, Mabrouk T, Dugourd D, Dezfulian H, Harel J: Presence of the LEE (locus of enterocyte effacement) in pig attaching and effacing Escherichia coli and characterization of eae, espA, espB and espD genes of PEPEC (pig EPEC) strain 1390.

    Microb Pathog 2000, 28(5):291-300. PubMed Abstract | Publisher Full Text OpenURL

  24. Beutin L, Kaulfuss S, Herold S, Oswald E, Schmidt H: Genetic analysis of enteropathogenic and enterohemorrhagic Escherichia coli serogroup O103 strains by molecular typing of virulence and housekeeping genes and pulsed-field gel electrophoresis.

    J Clin Microbiol 2005, 43(4):1552-1563. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  25. Camguilhem R, Milon A: Biotypes and O serogroups of Escherichia coli involved in intestinal infections of weaned rabbits: clues to diagnosis of pathogenic strains.

    J Clin Microbiol 1989, 27(4):743-747. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  26. Kim CC, Joyce EA, Chan K, Falkow S: Improved analytical methods for microarray-based genome-composition analysis.

    Genome Biol 2002, 3(11):RESEARCH0065. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  27. Saeed AI, Sharov V, White J, Li J, Liang W, Bhagabati N, Braisted J, Klapa M, Currier T, Thiagarajan M, Sturn A, Snuffin M, Rezantsev A, Popov D, Ryltsov A, Kostukovich E, Borisovsky I, Liu Z, Vinsavich A, Trush V, Quackenbush J: TM4: a free, open-source system for microarray data management and analysis.

    Biotechniques 2003, 34(2):374-378. PubMed Abstract OpenURL

  28. McDaniel TK, Jarvis KG, Donnenberg MS, Kaper JB: A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens.

    Proc Natl Acad Sci USA 1995, 92(5):1664-1668. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  29. Bielaszewska M, Sonntag AK, Schmidt MA, Karch H: Presence of virulence and fitness gene modules of enterohemorrhagic Escherichia coli in atypical enteropathogenic Escherichia coli O26.

    Microbes Infect 2007, 9(7):891-897. PubMed Abstract | Publisher Full Text OpenURL

  30. Bertin Y, Boukhors K, Livrelli V, Martin C: Localization of the insertion site and pathotype determination of the locus of enterocyte effacement of shiga toxin-producing Escherichia coli strains.

    Appl Environ Microbiol 2004, 70(1):61-68. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  31. Hartleib S, Prager R, Hedenstrom I, Lofdahl S, Tschape H: Prevalence of the new, SPI1-like, pathogenicity island ETT2 among Escherichia coli.

    Int J Med Microbiol 2003, 292(7–8):487-493. PubMed Abstract | Publisher Full Text OpenURL

  32. Clermont O, Bonacorsi S, Bingen E: Rapid and simple determination of the Escherichia coli phylogenetic group.

    Appl Environ Microbiol 2000, 66(10):4555-4558. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  33. Girardeau JP, Dalmasso A, Bertin Y, Ducrot C, Bord S, Livrelli V, Vernozy-Rozand C, Martin C: Association of virulence genotype with phylogenetic background in comparison to different seropathotypes of Shiga toxin-producing Escherichia coli isolates.

    J Clin Microbiol 2005, 43(12):6098-6107. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  34. Gruenheid S, Sekirov I, Thomas NA, Deng W, O'Donnell P, Goode D, Li Y, Frey EA, Brown NF, Metalnikov P, Pawson T, Ashman K, Finlay BB: Identification and characterization of NleA, a non-LEE-encoded type III translocated virulence factor of enterohaemorrhagic Escherichia coli O157:H7.

    Mol Microbiol 2004, 51(5):1233-1249. PubMed Abstract | Publisher Full Text OpenURL

  35. Afset JE, Bruant G, Brousseau R, Harel J, Anderssen E, Bevanger L, Bergh K: Identification of virulence genes linked with diarrhea due to atypical enteropathogenic Escherichia coli by DNA microarray analysis and PCR.

    J Clin Microbiol 2006, 44(10):3703-3711. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  36. Karmali MA, Mascarenhas M, Shen S, Ziebell K, Johnson S, Reid-Smith R, Isaac-Renton J, Clark C, Rahn K, Kaper JB: Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease.

    J Clin Microbiol 2003, 41(11):4930-4940. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  37. Frankel G, Phillips AD: Attaching effacing Escherichia coli and paradigms of Tir-triggered actin polymerization: getting off the pedestal.

    Cell Microbiol 2008, 10(3):549-556. PubMed Abstract | Publisher Full Text OpenURL

  38. Ogura Y, Ooka T, Whale A, Garmendia J, Beutin L, Tennant S, Krause G, Morabito S, Chinen I, Tobe T, Abe H, Tozzoli R, Caprioli A, Rivas M, Robins-Browne R, Hayashi T, Frankel G: TccP2 of O157:H7 and non-O157 enterohemorrhagic Escherichia coli (EHEC): challenging the dogma of EHEC-induced actin polymerization.

    Infect Immun 2007, 75(2):604-612. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  39. Whale AD, Garmendia J, Gomes TA, Frankel G: A novel category of enteropathogenic Escherichia coli simultaneously utilizes the Nck and TccP pathways to induce actin remodelling.

    Cell Microbiol 2006, 8(6):999-1008. PubMed Abstract | Publisher Full Text OpenURL

  40. Whale AD, Hernandes RT, Ooka T, Beutin L, Schuller S, Garmendia J, Crowther L, Vieira MA, Ogura Y, Krause G, Phillips AD, Gomes TA, Hayashi T, Frankel G: TccP2-mediated subversion of actin dynamics by EPEC 2 – a distinct evolutionary lineage of enteropathogenic Escherichia coli.

    Microbiology 2007, 153(Pt 6):1743-1755. PubMed Abstract | Publisher Full Text OpenURL

  41. Deng W, Puente JL, Gruenheid S, Li Y, Vallance BA, Vazquez A, Barba J, Ibarra JA, O'Donnell P, Metalnikov P, Ashman K, Lee S, Goode D, Pawson T, Finlay BB: Dissecting virulence: systematic and functional analyses of a pathogenicity island.

    Proc Natl Acad Sci USA 2004, 101(10):3597-3602. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  42. Makino S, Tobe T, Asakura H, Watarai M, Ikeda T, Takeshi K, Sasakawa C: Distribution of the secondary type III secretion system locus found in enterohemorrhagic Escherichia coli O157:H7 isolates among Shiga toxin-producing E. coli strains.

    J Clin Microbiol 2003, 41(6):2341-2347. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  43. Ren CP, Chaudhuri RR, Fivian A, Bailey CM, Antonio M, Barnes WM, Pallen MJ: The ETT2 gene cluster, encoding a second type III secretion system from Escherichia coli, is present in the majority of strains but has undergone widespread mutational attrition.

    J Bacteriol 2004, 186(11):3547-3560. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  44. Dziva F, van Diemen PM, Stevens MP, Smith AJ, Wallis TS: Identification of Escherichia coli O157:H7 genes influencing colonization of the bovine gastrointestinal tract using signature-tagged mutagenesis.

    Microbiology 2004, 150(Pt 11):3631-3645. PubMed Abstract | Publisher Full Text OpenURL

  45. van Diemen PM, Dziva F, Stevens MP, Wallis TS: Identification of enterohemorrhagic Escherichia coli O26:H- genes required for intestinal colonization in calves.

    Infect Immun 2005, 73(3):1735-1743. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  46. Kaper JB: Defining EPEC.

    Rev Microbiol Sao Paulo 1996, 27:130-133. OpenURL

  47. Malik A, Toth I, Beutin L, Schmidt H, Taminiau B, Dow MA, Morabito S, Oswald E, Mainil J, Nagy B: Serotypes and intimin types of intestinal and faecal strains of eae + Escherichia coli from weaned pigs.

    Vet Microbiol 2006, 114(1–2):82-93. PubMed Abstract | Publisher Full Text OpenURL

  48. Afset JE, Anderssen E, Bruant G, Harel J, Wieler L, Bergh K: Phylogenetic backgrounds and virulence profiles of atypical enteropathogenic Escherichia coli strains from a case-control study using multilocus sequence typing and DNA microarray analysis.

    J Clin Microbiol 2008, 46(7):2280-2290. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  49. Vieira MA, Andrade JR, Trabulsi LR, Rosa AC, Dias AM, Ramos SR, Frankel G, Gomes TA: Phenotypic and genotypic characteristics of Escherichia coli strains of non-enteropathogenic E. coli (EPEC) serogroups that carry EAE and lack the EPEC adherence factor and Shiga toxin DNA probe sequences.

    J Infect Dis 2001, 183(5):762-772. PubMed Abstract | Publisher Full Text OpenURL

  50. Trabulsi LR, Keller R, Tardelli Gomes TA: Typical and atypical enteropathogenic Escherichia coli.

    Emerg Infect Dis 2002, 8(5):508-513. PubMed Abstract | Publisher Full Text OpenURL

  51. Nicholls L, Grant TH, Robins-Browne RM: Identification of a novel genetic locus that is required for in vitro adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to epithelial cells.

    Mol Microbiol 2000, 35(2):275-288. PubMed Abstract | Publisher Full Text OpenURL

  52. Dozois CM, Dho-Moulin M, Bree A, Fairbrother JM, Desautels C, Curtiss R 3rd: Relationship between the Tsh autotransporter and pathogenicity of avian Escherichia coli and localization and analysis of the Tsh genetic region.

    Infect Immun 2000, 68(7):4145-4154. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  53. Johnson JR, Stell AL: Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise.

    J Infect Dis 2000, 181(1):261-272. PubMed Abstract | Publisher Full Text OpenURL

  54. Benz I, Schmidt MA: Cloning and expression of an adhesin (AIDA-I) involved in diffuse adherence of enteropathogenic Escherichia coli.

    Infect Immun 1989, 57(5):1506-1511. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  55. Shen S, Mascarenhas M, Morgan R, Rahn K, Karmali MA: Identification of four fimbria-encoding genomic islands that are highly specific for verocytotoxin-producing Escherichia coli serotype O157 strains.

    J Clin Microbiol 2005, 43(8):3840-3850. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  56. Zhang L, Chaudhuri RR, Constantinidou C, Hobman JL, Patel MD, Jones AC, Sarti D, Roe AJ, Vlisidou I, Shaw RK, Falciani F, Stevens MP, Gally DL, Knutton S, Frankel G, Penn CW, Pallen MJ: Regulators encoded in the Escherichia coli type III secretion system 2 gene cluster influence expression of genes within the locus for enterocyte effacement in enterohemorrhagic E. coli O157:H7.

    Infect Immun 2004, 72(12):7282-7293. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  57. Oswald E, Schmidt H, Morabito S, Karch H, Marches O, Caprioli A: Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant.

    Infect Immun 2000, 68(1):64-71. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  58. Krause G, Zimmermann S, Beutin L: Investigation of domestic animals and pets as a reservoir for intimin- (eae) gene positive Escherichia coli types.

    Vet Microbiol 2005, 106(1–2):87-95. PubMed Abstract | Publisher Full Text OpenURL

  59. Ishii S, Meyer KP, Sadowsky MJ: Relationship between phylogenetic groups, genotypic clusters, and virulence gene profiles of Escherichia coli strains from diverse human and animal sources.

    Appl Environ Microbiol 2007, 73(18):5703-5710. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  60. Kelly M, Hart E, Mundy R, Marches O, Wiles S, Badea L, Luck S, Tauschek M, Frankel G, Robins-Browne RM, Hartland EL: Essential role of the type III secretion system effector NleB in colonization of mice by Citrobacter rodentium.

    Infect Immun 2006, 74(4):2328-2337. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  61. Roe AJ, Tysall L, Dransfield T, Wang D, Fraser-Pitt D, Mahajan A, Constandinou C, Inglis N, Downing A, Talbot R, Smith DG, Gally DL: Analysis of the expression, regulation and export of NleA-E in Escherichia coli O157:H7.

    Microbiology 2007, 153(Pt 5):1350-1360. PubMed Abstract | Publisher Full Text OpenURL

Have something to say? Post a comment on this article!


© 1999-2009 BioMed Central Ltd unless otherwise stated. Part of Springer Science+Business Media.