Table 2

HV1 types observed in groups described in Table 1.

HV1 type

Nucleotide sequence of HV1 and encoded peptide


1

CAAGCACCAGTAGCACCAGCAGCA

Q A P V A P A A


2

CAAGCATCAGGAGCACCAGCAGCA

Q A S G A P A A


3

CAAGCACCAGTGGCACCAGCAGCA

Q A P V A P A A


4

CAAGCACCACAAGGAGCACCAGCA

Q A P Q G A P A


5

CAAGCACCAGCAGTACCACCAGCA

Q A P A V P P A


6

CAAGTAGTACAAGTAGTACAAGTAGCA

Q V V Q V V Q V A


7

CAAGCACCAGCAGGAGTAGTACAAGTAGCACAA

Q A P A G V V Q V A Q


8

CAAGCACCAGCAGGAGTAGTACAAG

    G
AGCACAA

Q A P A G V V Q V A Q


9

CAAGCACAAGTAGTACAAGGAGCACAA

Q A Q V V Q G A Q


10

CAAGCACAAGGAGTACAAGGAGCACAA

Q A Q G V Q G A Q


11

CAAGCATTAGGAGTACAA

Q A L G V Q


12

CAAGCACAAGGAGGAGCAGCAGCAGGAGCACAA

Q A Q G G A A A G A Q


13

CAAGCAAAAGTAGTACAAGGAGCACAAGTAGCACAA

Q A K V V Q G A Q V A Q


14

CAAGCACCACAAGCAGCACCAGCAGCG

Q A P Q A A P A A


15

CAAAGACCACAAGGAGCACCAGCA

Q R P Q G A P A


16

CAAGCAGTACAAGGAGCACAA

Q A V Q G A Q


17

CAACAACAAGTGGCACAAGTAGCACAA

Q Q Q V A Q V A Q


18

CAAGCAGCAGGAGGAGCAGCG

Q A A G G A A


19

CAAGCAGCAGCACAAAAACAA

Q A A A Q K Q


20

CGGGCGCGAGGAGTACAAGGAGCACAA

R A R G V Q G A Q


21

CAAGCACAAGGAGCAGGAGGAGCAGCG

Q A Q G A G G A A


22

CAAGCAGTACAAGGAGCAGCG

Q A V Q G A A


23

CAAGCAGTACAAGGAGCAGTG

Q A V Q G A V


24

CAAGCACAAGTAGTACAAAAACAA

Q A Q V V Q K Q


25

CAAGCACAAGTAGTACAAGTAGCACAA

Q A Q V V Q V A Q


26

CAAGCAGCAGTAGTAGCG

Q A A V V A


27

CAAGCAGTAGGAGTAGTAGCG

Q A V G V V A


28

CAAGCAGCAGGAGCAGTAGCG

Q A A G A V A


29

CAAAATCAAGCAGCACCAGCAGCG

Q N Q A A P A A


30

CAAGCAGCAGGAGTAGTAGCG

Q A A G V V A


31

CAACAACAAGTACCACAAGGAGCACAA

Q Q Q V P Q G A Q


Keely and Stringer BMC Genomics 2009 10:367   doi:10.1186/1471-2164-10-367

Open Data