Table 1

Polymorphic microsatellite markers that were screened on a panel of captive tigers (n = 21)

Locus

Primer Sequence (5'-3')

Repeat Type

Tm

k

Ho

He

PIC


D15

D15F: 5' TGTGACCTTTCTCTAGTTTC

D15R: 5' GCACAAAACATTCAGTCTCC

(CA)22, simple

51

8

0.381

0.740

0.689

3E6

3E6F: 5' CCTGGGGATAATAAAACTAGTA

2E6R: 5'CATGAATGAATCTTTACACTGA

(TAA)11, simple

56

5

0.571

0.684

0.606

E21B

E21F: 5' GCGATAAAGGCTGGCAGAGG

E21BR: 5' CTTTGAGGGTCTGTTCTACTGTGA

(CA)21, simple

61

5

0.667

0.718

0.657

D10

D10F: 5' CCCTCTCTGTCCCTCCCTTG

D10R: 5' GCCGTTTCCCTCATGCTACA

(GT)14, simple

63

5

0.524

0.812

0.759

E7

E7F: 5'GCCCCAAAGCCCTAAAATAA

E7R: 5'GCATGTCGGACAGTAAAGCA

(CA)11CG(CA)4, interrupted

55

7

0.571

0.662

0.600

C34

C34F: 5'CTCCACACTGAGCATGGAAA

C34R: 5'CAACCAAAGGCAGGAACAGT

(CT)21, simple

55

8

0.250

0.805

0.756

6HDZ003

Williamson et al (2002)

55

8

0.350

0.782

0.729

Fca304

Menotti-Raymond et al, 1999, Luo S-J et al, 2004

55

8

0.476

0.753

0.701

Fca43

Menotti-Raymond et al, 1999, Luo S-J et al, 2004

55

6

0.524

0.769

0.714

Fca139

Menotti-Raymond et al, 1999, Luo S-J et al, 2004

55

4

0.167

0.678

0.600


Tm = Annealing temperature; k = number of alleles; He = Expected heterozygosity; Ho = Observed Heterozygosity; PIC = Polymorphism Information Content

Bhagavatula and Singh BMC Genetics 2006 7:48   doi:10.1186/1471-2156-7-48

Open Data