Table 2

Primer sequences for the sequencing of horse PMEL17

Primer sequence

Forward primer (5'-3')

Reverse primer (5'-3')


5'UTR-Intron1

GGATCCCTTGTCAGTTTTGC

AGGAGAGGAAAAACCAGAGC

Exon 1-Exon 2 (LR)

GATGGATCCAGTGTCAGAGATG

ACTCTGGATACAGCTGCCTGTT

Intron 1-Exon 2

CGTGGGATGACGTTATCTTCT

AGTCAGGCCCCTGAATTTCT

Exon 2–3

GTCTCAAGGCAGCTCAGGAA

CATTGATGATGGTGTTGTTGG

Exon 3–4 (LR)

CTACACTGGTTGGGGCAAAT

TCTGAGACAGAGGGCCAGAT

Exon 3-Intron 3

GGTGGCCCTGAAGATCAGTA

AGGGAATTGGAGCCCTTAGA

Intron 3-Exon 4

CTCTCTGGGAGCCGTGTTAG

CCCAGGTCTTCCAGACGTAA

Exon 4-Intron 4

TCCCCAGGAACCTGATGATA

CTTCAGAGGTGGGACCAGAG

Exon 4–5

TCCCCAGGAACCTGATGATA

GCGGTGGTAGACAGTCACTT

Exon 5–6

AGTGTCGGGGCTGAGCAT

CAGGCCACAGCTTGTCTTTT

Exon 5–6(2)

TGCCCCTCGCTCACTCCCGCTCAGCCT

CATGAATGGGCTGGCATCTGGA

Exon 6–7

GGTAACGGTACAGAGTTGGTGGAA

GGACGATGTCCAGAGTGAGGGA

Exon 6–7(2)

AGGTGCCAACTGCAGAGC

GGACGATGTCCAGAGTGAGG

Exon 7-Intron 8

ATGGCACAGCCACCTTATTC

GAAAGGTGTCAGTTTAGGTCAGG

Exon 7–10

CCAGAGCCCCCTGCTGGATGG

TATATCAGAGATGCAAGCACCATA

Exon 9-Intron 10

AATGTGTCTTTGGCTGATGC

TCTGCCCCTCTTACAGGTGA

Intron 10-Exon 11

GCAGGGAAGCTTGTAGAGTGA

CTCTCACCAAAGGGGGAAG

Exon 10–11

AGAGGCAGGCCTTGGGCAG

TGCTCTCACCAAAGGGGGAAG

Exon 11–3'UTR

CAGGCGCAGACTTATGAAGC

AGGGAAGWCTGSRGRAAABA

Pyroseq. PCR primers, Ex 11

Biotin-TCCATTGCTTACCAGTTTCCTT

CTCACCAAAGGGGGAAGAG

Pyroseq. Seq primer, Ex 11

-

GCCCTGCTTCATAAGTCTG

Pyroseq. PCR primers, Int.9

CATGCCTGGTAGGTACTTGGA

Biotin-CCTCTTGACCTGTGAGCAGA

Pyroseq. Seq primer, Int 9.

GGGGAGTGGGCAGAGGCT

-

RACE primer

-

CCGGAGGGCAAAGGTCAGAGGTTG


Brunberg et al. BMC Genetics 2006 7:46   doi:10.1186/1471-2156-7-46

Open Data