Email updates

Keep up to date with the latest news and content from BMC Genetics and BioMed Central.

Open Access Research article

Fusion of the NUP98 gene with the LEDGF/p52 gene defines a recurrent acute myeloid leukemia translocation

Damian J Hussey12, Sarah Moore3, Mario Nicola3 and Alexander Dobrovic4*

Author Affiliations

1 Department of Haematology-Oncology, The Queen Elizabeth Hospital Woodville, SA 5011, Australia

2 University of Adelaide Department of Medicine, The Queen Elizabeth Hospital Woodville, SA 5011, Australia

3 Department of Haematology, Institute of Medical and Veterinary Science, Adelaide, SA 5006, Australia

4 Molecular Pathology, Department of Pathology, Peter MacCallum Cancer Institute, Locked Bag No 1 A'Beckett Street, Melbourne, Victoria, 8006, Australia

For all author emails, please log on.

BMC Genetics 2001, 2:20  doi:10.1186/1471-2156-2-20

The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2156/2/20


Received:1 October 2001
Accepted:23 November 2001
Published:23 November 2001

© 2001 Hussey et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.

Abstract

Background

The NUP98 gene is involved in multiple rearrangements in haematological malignancy. The leukemic cells in an acute myeloid leukemia (AML) patient with a t(9;11)(p22;p15) were recently shown to have a fusion between the NUP98 gene and the LEDGF gene but it was not demonstrated that this fusion was recurrent in other leukaemia patients with the same translocation.

Results

We used RT-PCR to analyse the leukemic cells from an AML patient who presented with a cytogenetically identical translocation as the sole chromosomal abnormality. A NUP98-LEDGF fusion transcript was observed and confirmed by sequencing. The reciprocal transcript was also observed. The fusion transcript was not detectable during remission and recurred at relapse. The breakpoints in the NUP98 and LEDGF genes were different to those previously reported. The NUP98 breakpoint occurs in the intron between exons 8 and 9. It is the most 5' breakpoint reported in a translocation involving the NUP98 gene. All of the LEDGF gene is included in the fusion except for exon 1 which codes for the first 24 amino terminal amino acids.

Conclusions

Our results show that fusion of the NUP98 and LEDGF genes is a new recurrent translocation in AML.

Background

The translocation, t(9;11)(p22;p15), was first reported in a patient with AML M1 [1]. Recently, a second AML M1 patient with a cytogenetically identical translocation was shown to have a fusion transcript between the 5' end of the NUP98 gene on 11p15 and the 3' end of the LEDGF gene on 9p22 [2].

We have identified a third AML patient with a cytogenetically identical translocation. The patient, a 60 year old Caucasian woman presented with a white cell count of 1.5 x 109/L due to neutropenia. The bone marrow showed 50% blasts and 30% promyelocytes. She was diagnosed as AML M2. Cytogenetics showed 46,XX,t(9;11)(p22;p15) [13 cells]/46,XX [2 cells]. Induction chemotherapy with ARA-C, idarubicin and etoposide was abandoned after the patient developed a severe neutropenic reaction at the end of the first course. Nevertheless, complete haematological and cytogenetic remission was obtained. After 54 months, the patient relapsed with frank leukemia and a white cell count of 50 x 109/L. Due to the patient's wishes, only supportive therapy was given, and she died of her disease a few days later with a rapidly escalating blast cell burden. Cytogenetics of the relapse peripheral blood showed the same karyotype as at presentation 46,XX,t(9;11)(p22;p15) [19 cells]/46,XX [3 cells].

We analysed the leukemic cells from this patient in order to determine whether the fusion of NUP98 and LEDGF as a result of the t(9;11)(p22;p15) is a recurrent event in AML.

Results and discussion

The NUP98 gene is known to be involved in multiple rearrangements in haematological malignancy [3-10]. The 11p15 breakpoint in our patient suggested possible disruption of the NUP98 gene. We therefore attempted a 3'RACE approach to test for the presence of a fusion mRNA using a method similar to that used to identify RAP1GDS1 as a fusion partner of NUP98 [9]. As the most 5' break in NUP98 known at the time occurred in the intron after exon 10 [9], we used a NUP98 forward primer from exon 9 for 3'RACE. This approach resulted in a number of RT-PCR products from the t(9;11) patient that were different in size from the NUP98 3'RACE products amplified from normal individuals. However sequence analysis of these products showed that they resulted from partially spliced NUP98 mRNAs rather than novel fusion mRNAs (results not shown).

Subsequently, an AML patient was reported in which the t(9;11)(p22;p15) resulted in an in-frame fusion of the NUP98 and LEDGF genes [2]. This involved fusion of NUP98 exon 9 to LEDGF exon 6. As RACE of our patient had failed to detect any fusions including exon 9 of NUP98, we used a NUP98 primer from exon 8 with a LEDGF reverse primer from exon 6 for RT-PCR (Figure 1). An RT-PCR product was obtained in which exon 8 of NUP98 was fused in-frame to exon 2 of LEDGF. The NUP98 breakpoint thus maps to the 5.5 kb intron between exons 8 and 9 and is the most 5' NUP98 breakpoint reported to date. The LEDGF breakpoint in our patient is more 5' than that found in the patient reported by Ahuja et al [2] and occurs within the 3.5 kb intron between exons 1 and 2.

thumbnailFigure 1. RT-PCR analysis of NUP98-LEDGF expression. RT-PCR for the NUP98-LEDGF fusion was performed as outlined in the materials and methods. RNA samples are from peripheral blood mononuclear cells taken from a normal donor (lane 1), bone marrow mononuclear cells taken from t(9;11) patient presentation (lane 2), and peripheral blood mononuclear cells taken from t(9;11) patient remission (lane 3) and relapse (lane 4). Lane 5 is a relapse specimen negative control RT-PCR without reverse transcriptase. M is pUC19/HpaII molecular weight marker. The lower panel shows the corresponding PBGD PCR control reactions.

We also used RT-PCR to assess expression of the NUP98-LEDGF fusion mRNA in remission peripheral blood taken twenty months after presentation. Using standard PCR conditions with 35 cycles of PCR (Figure 1), there was no fusion transcript visible. Even after first round PCR with 45 cycles followed by fully nested PCR with 45 cycles we did not detect NUP98-LEDGF fusion mRNA in the remission sample (data not shown). However, RT-PCR of the relapse specimen showed that the NUP98-LEDGF transcript was re-expressed consistent with the association of the translocation with the disease.

We were able to amplify the reciprocal LEDGF-NUP98 fusion transcript at presentation and relapse. Sequencing of this product showed an in-frame fusion of exon 2 of LEDGF to exon 9 of NUP98 as expected. The reciprocal transcript is unlikely to be important in the pathogenesis of the disease as the previous report did not observe a reciprocal fusion transcript [2]. However, it is possible that the reciprocal fusion transcript may modulate the course of the disease particularly in the light of the less aggressive form of the disease seen in our patient. Similar patient to patient differences in whether or not the reciprocal transcript is expressed have also been noted for other fusions including BCR-ABL and NUP98-RAP1GDS1[9,11].

We were also able to obtain RNA using fixed leukemic cells from the first reported t(9;11) patient [1]. This RNA was highly degraded and had an average length of 200 bases. Despite being able to amplify a 400 bp NUP98 RT-PCR product, we were unable to amplify a a smaller product corresponding to either of the 2 known NUP98-LEDGF fusions nor any of a number of other potential NUP98-LEDGF fusions that we tried.

The previously reported NUP98-LEDGF transcript [2] encodes a protein fusing the amino terminus of the NUP98 gene containing 28 of the 38 FG repeats with exon 6 onwards of p52/75. FG repeats in NUP98 fusion proteins have been shown to act as transactivation domains which recruit CBP/p300 [8,12]. The minimum number of FG repeats which are important for the transforming properties of NUP98 fusion proteins has not yet been defined. The fusion in our patient contains 23 FG repeats from NUP98. Interestingly, just after the breakpoint LEDGF exon 2 codes for an additional FG residue. It is unknown whether this residue is important for the function of the NUP98-LEDGF fusion protein.

The LEDGF gene codes for 2 transcriptional co-activators, p75 (LEDGF: Lens Epithelium Derived Growth Factor) and p52 which have different 3' ends generated by alternative splicing [15,13]. Both NUP98-p52 and NUP98-p75 fusion mRNAs were seen in our patient at presentation and relapse (data not shown) as well as in the previously characterised t(9;11) patient [2]. It remains to be determined whether one transcript is more important in the leukemogenic process.

p52 and p75 both contain a PWWP domain at their amino terminus [14]. PWWP is the core motif of a 70 amino acid domain found in a variety of nuclear proteins [14]. The PWWP domain was lost in the NUP98-LEDGF fusion described by Ahuja et al [2] and disrupted in the fusion described here. Interestingly, the PWWP domain is also found in NSD1, the most recently identified NUP98 partner gene and is absent in the NUP98-NSD1 fusion transcript [10].

The three AML patients with the t(9;11)(p22;p15) vary in their clinical picture (Table 1). At this stage, it is too early to determine which clinicopathological features are a hallmark of this translocation, especially as it is not clear as to whether the first patient's translocation has a similar molecular basis to the other two. Patients 2 and 3 have a more mature myeloid phenotype than that seen in patient 1. All three presented with the t(9;11)(p22;p15) as their sole cytogenetic abnormality. At relapse, the leukemic cells of both patients 2 and 3 had the same karyotype as at presentation whereas the relapse karyotype of patient 1 no longer showed the translocation.

Table 1. Clinical features, immunophenotype of patients with the t(9;11)(p22p15).

Some NUP98 translocations are associated with secondary leukemias that occur after treatment with topoisomerase II inhibitors [3-8,15]. The patient in this report had not received chemotherapy prior to her disease and prior chemotherapy was not mentioned in either of the other two case reports [1,2]. It seems that t(9;11)(p22;p15) is preferentially associated with de-novo AML rather than therapy related AML.

Conclusions

Our results show that fusion of the NUP98 and LEDGF genes is a recurrent translocation in AML. Further study is required to determine how this fusion gene promotes leukemia.

Materials and methods

RT-PCR analysis

RNA was obtained from bone marrow or peripheral blood mononuclear cells using Trizol (Invitrogen). RNA was reverse transcribed using Superscript II (Invitrogen). 3' RACE was performed using the 3' RACE System for Rapid Amplification of cDNA Ends (Invitrogen). The manufacturer's protocol for "First Strand cDNA Synthesis of Transcripts with High GC Content" was used. RT-PCR to amplify the NUP98-LEDGF fusion was performed using a NUP98 forward primer from exon 8 (N988F 5'ACCAGCCTCTTCAGCAAACCATTTG3') and a LEDGF reverse primer from exon 6 (L826R 5'AACAGATGCTGTTGCTGTTGTCAC3'). NUP98 exons are numbered according to Genbank AB040538 and LEDGF exons are numbered according to reference 16. Subsequently, the N988F primer was used in combination with either a p52 reverse primer (5'CTTCATCTCTTGTTTGCTCCACTTG3') or a p75 reverse primer (5'CTCAGCATGTATCCTTTGAAGTCG3') to amplify NUP98-p52 and NUP98-p75 fusion transcripts respectively. The PBGD transcript was amplified using primers specific for the housekeeping isoform, (5'CTTTCCAAGCGGAGCCATGTCTGG3' and 5'CATGAGGGTTTTCCCGCTTGCAGA3'). PCR was performed using HotStarTaq (Qiagen) according to the manufacturer's instructions with an initial incubation at 95°C for 15 minutes followed by 35 cycles of 96°C for 30 seconds, 65°C for 45 seconds and 72°C for 1 minute.

Acknowledgements

We thank Professor LC Chan for fixed cells and information on patient 1 and Marilyn Slovak for supplying further information on patient 2. We thank John Norman and Professor RE Sage of the Haematology-Oncology Department of the Queen Elizabeth Hospital for their support and information on patient 3. This work is supported by a National Health & Medical Research Council grant to AD.

References

  1. Ha SY, Chan LC: Biphenotypic leukemia with t(9;11)(p22;p15).

    Cancer Genet Cytogenet 1994, 76:116-117. PubMed Abstract | Publisher Full Text OpenURL

  2. Ahuja HG, Hong J, Aplan PD, Tcheurekdjian L, Forman SJ, Slovak ML: t(9;11)(p22;p15) in acute myeloid leukemia results in a fusion between NUP98 and the gene encoding transcriptional coactivators p52 and p75-lens epithelium-derived growth factor (LEDGF).

    Cancer Res 2000, 60:6227-6229. PubMed Abstract | Publisher Full Text OpenURL

  3. Borrow J, Shearman AM, Stanton VP Jr, et al.: The t(7;11)(p15;p15) translocation in acute myeloid leukemia fuses the genes for nucleoporin NUP98 to class I homeoprotein HOXA9.

    Nature Genet 1996, 12:159-167. PubMed Abstract OpenURL

  4. Nakamura T, Largaespada DA, Lee MP, et al.: Fusion of the nucleoporin gene NUP98 to HOXA9 by chromosomal translocation t(7;11)(p15;p15) in human myeloid leukemia.

    Nature Genet 1996, 12:154-158. PubMed Abstract OpenURL

  5. Arai Y, Hosoda F, Kobayashi H, et al.: The inv(11)(p15q22) chromosome translocation of de novo and therapy-related myeloid malignancies results in fusion of the nucleoporin gene NUP98 with the putative RNA helicase gene DDX10.

    Blood 1997, 89:3936-3944. PubMed Abstract | Publisher Full Text OpenURL

  6. Raza-Egilmez SZ, Jani-Sait SN, Grossi M, Higgins MJ, Shows TB, Aplan PD: NUP98-HOXD13 gene fusion in therapy-related acute myelogenous leukemia.

    Cancer Res 1998, 58:4269-4273. PubMed Abstract OpenURL

  7. Nakamura T, Yamazaki Y, Hatano Y, Miura I: NUP98 is fused to PMX1 homeobox gene in human acute myelogenous leukemia with chromosome translocation t(1;11)(q23;p15).

    Blood 1999, 94:741-747. PubMed Abstract | Publisher Full Text OpenURL

  8. Ahuja HG, Felix CA, Aplan PD: The t(11;20)(p15;q11) chromosomal translocation associated with therapy-related myelodysplastic syndrome results in an NUP98-TOP1 fusion.

    Blood 1999, 94:3258-3261. PubMed Abstract | Publisher Full Text OpenURL

  9. Hussey DJ, Nicola M, Moore S, Peters GB, Dobrovic A: The t(4;11)q21;p15) translocation fuses the NUP98 and RAP1GDS1 genes and is recurrent in T-cell acute lymphocytic leukemia.

    Blood 1999, 94:2072-2079. PubMed Abstract | Publisher Full Text OpenURL

  10. Jaju RJ, Fidler C, Haas OA, et al.: A novel gene, NSD1, is fused to NUP98 in the t(5;11)(q35;p15.5) in de novo childhood acute myeloid leukemia.

    Blood 2001, 98:1264-1267. PubMed Abstract | Publisher Full Text OpenURL

  11. Melo JV, Gordon DE, Cross NC, Goldman JM: The ABL-BCR fusion gene is expressed in chronic myeloid leukemia.

    Blood 1993, 81:158-165. PubMed Abstract OpenURL

  12. Kasper LH, Brindle PK, Schnabel CA, et al.: CREB binding protein interacts with nucleoporin-specific FG repeats that activate transcription and mediate NUP98-HOX9 oncogenicity.

    Mol Cell Biol 1999, 19:764-776. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  13. Ge H, Si Y, Roeder RG: Isolation of cDNAs encoding novel transcription coactivators p52 and p75 reveals an alternate regulatory mechanism of transcriptional activation.

    EMBO J 1998, 17:6723-6729. PubMed Abstract | Publisher Full Text OpenURL

  14. Stec I, Nagl SB, van Ommen GJ, den Dunnen JT: The PWWP domain: a potential protein-protein interaction domain in nuclear proteins influencing differentiation?

    FEBS Lett 2000, 473:1-5. PubMed Abstract | Publisher Full Text OpenURL

  15. Ahuja HG, Felix CA, Aplan PD: Potential role for DNA topoisomerase II poisons in the generation of t(11;20)(p15;q11) translocations.

    Genes Chromosomes Cancer 2000, 29:96-105. PubMed Abstract | Publisher Full Text OpenURL

  16. Singh DP, Kimura A, Chylack LT Jr, Shinohara T: Lens epithelium-derived growth factor (LEDGF/p75) and p52 are derived from a single gene by alternative splicing.

    Gene 2000, 242:265-273. PubMed Abstract | Publisher Full Text OpenURL