Table 2

Oligonucleotide pairs used in the amplification and sequencing

Fragment

Annealing

Name

CRS reference

Sequence (5'–3')

size (pb)

temp.(°C)


L16340

(16318–16340)

AGCCATTTACCGTACATAGCACA

681

52

H408

(429–408)

TGTTAAAAGTGCATACCGCCA

L382

(362–382)

CAAAGAACCCTAACACCAGCC

603

56

H945

(964–945)

GGGAGGGGGTGATCTAAAAC

L923

(902–923)

GTCACACGATTAACCCAAGTCA

607

56

H1487

(1508–1487)

GTATACTTGAGGAGGGTGACGG

L1466

(1445–1466)

GAGTGCTTAGTTGAACAGGGCC

629

58

H2053

(2073–2053)

TTAGAGGGTTCTGTGGGCAAA

L2025

(2004–2025)

GCCTGGTGATAGCTGGTTGTCC

609

52

H2591

(2612–2591)

GGAACAAGTGATTATGCTACCT

L2559

(2538–2559)

CACCGCCTGCCCAGTGACACAT

591

56

H3108

(3128–3108)

TCGTACAGGGAGGAATTTGAA

L3073

(3051–3073)

AAAGTCCTACGTGATCTGAGTTC

640

52

H3670

(3690–3670)

GGCGTAGTTTGAGTTTGATGC

L3644

(3625–3644)

GCCACCTCTAGCCTAGCCGT

623

58

H4227

(4247–4227)

ATGCTGGAGATTGTAATGGGT

L4210

(4189–4210)

CCACTCACCCTAGCATTACTTA

625

55

H4792

(4813–4792)

ACTCAGAAGTGAAAGGGGGCTA

L4750

(4729–4750)

CCAATACTACCAATCAATACTC

599

52

H5306

(5327–5306)

GGTGATGGTGGCTATGATGGTG

L5278

(5259–5278)

TGGGCCATTATCGAAGAATT

593

58

H5832

(5851–5832)

GACAGGGGTTAGGCCTCTTT

L5781

(5762–5781)

AGCCCCGGCAGGTTTGAAGC

626

58

H6367

(6387–6367)

TGGCCCCTAAGATAGAGGAGA

L6337

(6318–6337)

CCTGGAGCCTCCGTAGACCT

601

58

H6899

(6918–6899)

GCACTGCAGCAGATCATTTC

L6869

(6850–6869)

CCGGCGTCAAAGTATTTAGC

578

58

H7406

(7427–7406)

GGGTTCTTCGAATGTGTGGTAG

L7379

(7358–7379)

AGAAGAACCCTCCATAAACCTG

580

56

H7918

(7937–7918)

AGATTAGTCCGCCGTAGTCG

L7882

(7861–7882)

TCCCTCCCTTACCATCAAATCA

506

56

H8345

(8366–8345)

TTTCACTGTAAAGAGGTGTTGG

L8299

(8280–8299)

ACCCCCTCTAGAGCCCACTG

603

56

H8861

(8882–8861)

GAGCGAAAGCCTATAATCACTG

L8799

(8779–8799)

CTCGGACTCCTGCCTCACTCA

638

58

H9397

(9416–9397)

GTGGCCTTGGTATGTGCTTT

L9362

(9342–9362)

GGCCTACTAACCAACACACTA

609

56

H9928

(9950–9928)

AACCACATCTACAAAATGCCAGT

L9886

(9865–9886)

TCCGCCAACTAATATTTCACTT

617

56

H10462

(10481–10462)

AATGAGGGGCATTTGGTAAA

L10403

(10383–10403)

AAAGGATTAGACTGAACCGAA

612

56

H10975

(10994–10975)

CCATGATTGTGAGGGGTAGG

L10949

(10930–10949)

CTCCGACCCCCTAACAACCC

617

58

H11527

(11546–11527

CAAGGAAGGGGTAGGCTATG

L11486

(11467–11486

AAAACTAGGCGGCTATGGTA

629

56

H12076

(12095–12076

GGAGAATGGGGGATAGGTGT

L12028

(12008–12028

GGCTCACTCACCCACCACATT

615

58

H12603

(12623–12603

ACGAACAATGCTACAGGGATG

L12572

(12553–12572

ACAACCCAGCTCTCCCTAAG

591

56

H13124

(13143–13124

ATTTTCTGCTAGGGGGTGGA

L13088

(13068–13088

AGCCCTACTCCACTCAAGCAC

618

58

H13666

(13685–13666

AGGGTGGGGTTATTTTCGTT

L13612

(13593–13612

AAGCGCCTATAGCACTCGAA

614

56

H14186

(14206–14186

TGGTTGAACATTGTTTGTTGG

L13612

(13593–13612

AAGCGCCTATAGCACTCGAA

614

56

H14186

(14206–14186

TGGTTGAACATTGTTTGTTGG

L14125

(14104–14125

TCTTTCTTCTTCCCACTCATCC

602

58

H14685

(14705–14685

CATTGGTCGTGGTTGTAGTCC

L14650

(14629–14650

CCCCATTACTAAACCCACACTC

604

58

H15211

(15232–15211

TTGAACTAGGTCTGTCCCAATG

L15162

(15143–15162

CTCCCGTGAGGCCAAATATC

597

58

H15720

(15739–15720

GTCTGCGGCTAGGAGTCAAT

L15676

(15657–15676

TCCCCATCCTCCATATATCC

524

56

H16157

(16180–16157

TGATGTGGATTGGGTTTTTATGTA

L15996

(15975–15996

CTCCACCATTAGCACCCAAAGC

446

58

H16401

(16420–16401

TGATTTCACGGAGGATGGTG


Maca-Meyer et al. BMC Genetics 2001 2:13   doi:10.1186/1471-2156-2-13

Open Data