Table 4

Primers used

Genomic

Name

Nucleotide sequence

region

Position*

Strandedness

specificity


ga31

ttgtcggtgctgatctcagtgga

exon 3

362 to 383

sense

RHD

ga41

acatgatgcacatctacgtgttcgc

exon 4

503 to 527

sense

RHD/RHCE

ga42

cagacaaactgggtatcgttgctg

exon 4

625 to 602

antisense

RHD/RHCE

ga51

ctgctcaccttgctgatcttccc

intron 5/exon.

5 8 to 787

antisense

RHD

ga61

caggtacttggctcccccgac

exon 6

936 to 916

antisense

RHD

ga62

ttatgtgcacagtgcggtgttgg

exon 6

804 to 826

sense

RHD/RHCE

ga71

gttgtaaccgagtgctggggattc

exon 7

944 to 967

sense

RHD/RHCE

ga72

tgccggctccgacggtatc

exon 7

1066 to 1048

antisense

RHD

rb12

tcctgaacctgctctgtgaagtgc

intron 4

198 to 175

antisense

RHD

rb21

aggtccctcctccagcac

intron 3

28 to 11

antisense

RHD/RHCE

rb24

agacctttggagcaggagtg

intron 4

-53 to -34

sense

RHD/RHCE

rb26

aggggtgggtagggaatatg

intron 6

-62 to -43

sense

RHD/RHCE

rb45

acactgttgrctgaatttcggtgc

intron 1

164 to 139

antisense

RHD/RHCE

rb51

gcatgacgtgttctgcctcttg

intron 7

-3365 to - 3386

antisense

RHD

rb52

ccaggttgttaagcattgctgtacc

intron 7

-3433 to -3409

sense

RHD

re04

aggtcacatccatttatcccactg

promoter

-2498 to -2474

sense

RHD/RHCE

re08

gggcttgggacttagttctaac

promoter

-858 to -879

antisense

RHD/RHCE

re09

cgactgggtgattaaaatctcc

promoter

-1280to-1259

sense

RHD/RHCE

re011d

gcagccaacttcccctgtg

promoter

-883 to -905

antisense

RHD

re012

tccactttccacctccctgc

promoter

-1148to-1122

sense

RHD

relld

agaagatgggggaatctttttcct

intron 1

129 to 106

antisense

RHD/RHCE

re41

cgatacccagtttgtctgccatgc

exon 4

608 to 631

sense

RHD/RHCE

re71

acccagcaagctgaagttgtagcc

exon 7

1,008 to 985

antisense

RHD

re74

tatccatgaggtgctgggaac

intron 7

-244 to -224

sense

RHD/RHCE

re721

ctggaggctctgagaggttgag

intron 7

-348 to -326

sense

RHD

re83

gagattaaaaatcctgtgctcca

intron 8

-54 to - 34

sense

RHD/RHCE

re93

cacccgcatgtcagactatttggc

intron 9

320 to 297

antisense

RHD/RHCE

re93k

gccaaatagtttgacatgcgggtg

intron 9

297 to 320

sense

RHD/RHCE

re94

cttggtcatcaaaatatttagcct

exon 9

1216 to 1193

antisense

RHD

re916

gtttttgaggcaaagtctcgctc

intron 9

1689 to 1666

antisense

RHD/RHCE

rea7

tgttgcctgcatttgtacgtgag

3' UTR

1311 to 1333

sense

RHD/RHCE

rend31k

cctccccaacccagacagaattag

AJ252311

8506 to 8529

sense

not applicable

rend9b1

cactgcacttggcaccattgag

AL031432

29489 to 29468

antisense

not applicable

rend9b2

ttccgaaggctgcttttccc

AL031432

28840 to 28859

sense

not applicable

Rh152Tb

gatattactgatgaccatcctcatgg

exon3

480 to 455

antisense

RHCE

Rh223Vf

ttgtggatgttctggccaagtg

exon 5

646 to 667

sense

RHCE

Rh245Vb

gctgtcaccactctgactgctac

exon5

755 to 733

antisense

RHD

RhPsiB

tctgatctttatcctccgttccctc

exon 4

601 to 577

antisense

RHD

RhPsiF

agacagactaccacatgaacttac

intron 3

-38 to-15

sense

RHDψ

RhX1f1

cgctgcctgcccctctga

exon 1

31 to 48

sense

RHD(W16X)

rr4

agcttactggatgaccacca

3'UTR

1,541 to 1,522

antisense

RHD


*The positions of the synthetic oligonucleotides are indicated relative to their distances from the first nucleotide position of the start codon ATG for all primers in the promoter and in the exons including the 3' untranslated part of exon 10, relative to their adjacent exon/intron boundaries of RHCE for primers in introns; and according to the numbering in the genomic sequences indicated. Primers rh1 [44], ga31 (previously dubbed D-3-383), ga41 (D-4-527), ga42 (D-4-602), ga51 (D-5-787), ga61 (D-6-916), ga62 (D-6-826), ga71 (D-7-967), ga72 (D-7-1048) [27], rb5, rb12, rb24, rh5, rh7 [31], rb21, rb26, re11d, re71, re74, re83, re93, rr4 [32], re012 [29], re011d and rea7 [7] have been published previously. 5' UTR: 5' untranslated region of exon 1; 3' UTR: 3' untranslated region of exon 10. Accession number of nucleic acid sequence in EMBL/GenBank/DDBJ; AJ252311 represents upstream Rhesus box; AL031431 Chromosome 1 genomic clone dJ465N24.

Wagner et al. BMC Genetics 2001 2:10   doi:10.1186/1471-2156-2-10

Open Data