Table 3

Primers used for amplification, sequencing and genotyping of the ovine GDF9 gene
Name Direction Position Sequence5’-3’
7916 Forward 1744 - 1763a ATGGGGAAATGTGTTCCTTG
7917 Reverse 2187 - 2206a CCACCCATTAACCAATCTGC
7918 Forward 3205 - 3224a GGGGAGAAAAGGGACAGAAG
7919 Reverse 4283 - 4302a GCCAGGACACTCATGGTTTT
7979 Forward 3863 - 3882a AGGAGAGTGCCAGCTCTGAA
7980 Reverse 4443 - 4462a CATGAGGAAGGCAGCTGTTA
GDF9F Forward 3983 - 4002a GCTTTAGTCAGCTGAAGTGG
GDF9R Reverse 4039 - 4058a CAGTCCCCTTTACAGTATCG
GDF9E Extension 3996 - 4014a GAAGTGGGACAACTGGATT

aPositions are numbered according to the genomic sheep GDF9 sequence (Accession number: AF078545.2).

Våge et al.

Våge et al. BMC Genetics 2013 14:1   doi:10.1186/1471-2156-14-1

Open Data