Additional file 1.

Table S1. Reference gene primers tested. BA = Bérubé and Aguilar [38]; CW 2006 = Callicot and Womack [52]; RC 2009 = Cawthon [24]. Note that all reference gene primers used in assays II-IV had a CG-clamp (CGGCGGCGGGCGGCGCGGGCTGGGCGG) attached to increase annealing temperature as described in Cawthon (2009). * Caution; this primer pair was used in assay I in which primer efficiency was found to correlate with DNA concentration.

Format: DOC Size: 46KB Download file

This file can be viewed with: Microsoft Word Viewer

Olsen et al. BMC Genetics 2012 13:77   doi:10.1186/1471-2156-13-77