Table 1

Primers used for RT-PCR amplification ofB. bubalistyrosinase mRNA
Name Primer Sequence (5´- 3´) Product Size (bp) Annealing Temperature
1 ASB.TYR - F1 TGAAAGGGAAGAGTGTGGCTCCAT 411 60 °C
ASB.TYR - R8 TCGCCTTTCTGTGCAGCGGG
2 JP.TYR - F2 AGTCTTGGCCCTCCATCTTT 350 60 °C
JP.TYR - R2 GACTTCAGAGTCCCCAAGCA
3 ASB.TYR - F6 TCCCCACGGGCACCTATGGC 419 60 °C
ASB.TYR - R1 GTTGCATAAAGCCTGGCGACTGTT
4 ASB.TYR - F7 CATGGGAGGGCGCAACCCTG 533 60 °C
ASB.TYR - R2 AAGGAACCATGTAGGATTCCCGGT
5 ASB.TYR - F2 AACAGTCGCCAGGCTTTATGCAAC 439 60 °C
ASB.TYR - R2 AAGGAACCATGTAGGATTCCCGGT
6 JP.TYR - F4 GATCTGCCAATGATCCCATC 329 60 °C
JP.TYR - R4 AAGGACAGACCCAACCACAG
7 ASB.TYR - F3 TAGAACAAGCACAACGAATCTGGC 377 60 °C
ASB.TYR - R3 AAAGCAAGCACAGGTGGCTTCTAC
8 ASB.TYR - F4 ACCGGGAATCCTACATGGTTCCTT 225 60 °C
ASB.TYR - R4 TAAGTCCTCCCAGCACAGCAGTAA
9 ASB.TYR - F5 AATGTAGCCCTCCTCCTACTCAGGTA 215 60 °C
ASB.TYR - R5 GGGAACAAGTCATTCCACAATCAAGAGG
10 JP.TYR - F6 CAATAGAGCTGGGGCAAAAA 247 60 °C
JP.TYR - R6 TACCAAATGGCATCCTTTCC

Damé et al.

Damé et al. BMC Genetics 2012 13:62   doi:10.1186/1471-2156-13-62

Open Data