Table 4

Details on the sugarcane microsatellite loci derived from expressed sequence tags (ESTs)
Marker code Repeat motif Forward primer (5′3′) Reverse primer (5′3′) PCRe ATf Dg Allele number and size rangeh
ESTA26 a (TG)11 GGCAGCCCCACATCTTCCT GGGCACAAGCATCCGAACC 1 56.0 S 4 172-186
ESTA48 a (CA)8 AGCAACTCCGGCCTCTCCTG CTTTCTGTTTTGCTCCTCCGTCTG 1 62.7 S 10 233-295
ESTA53 a (TG)8 TGGAAATGGCAGCTGGTCTCGT ATGCACGTACCAGAGGGAGATTTG 1 58.9 S 9 168-192
ESTA61 a (AT)12 ACCTCAGTCTCCTCCTCAACC TATACTACACATGCACAGGCTACG 1 56.4 S 5 236-246
ESTB14 a (CGT)8 TGAGGGAATGAATGGACTGG CCACCACCACCATACCTGTC 1 52.0 S 9 285-315
ESTB55 a (CCA)5 CTTCTTGGCCTTGGCGTTACTGA GCTAGCTGGCCCCATTTCCTCT 1 60.0 S 3 118-124
ESTB60 a (TTG)10 AGCCGCAATGAATCCAACTG CTCTAGCTCCGACGATGATACCTC 1 61.0 S 8 157-206
ESTB82 a (CGT)9 CGTCGATCGAGATGAAGAAGG GAAGCAGTCGTGGAAGTGGAG 1 62.7 S 5 245-263
ESTB94 a (CTT)9 GAGGCAGCCAGGCAGGTCAC GGTGGCAGTGTTCAGGCAGATG 1 61.0 S 10 210-279
ESTB99 a (TCG)5 GAGGTCCTTCTTGTAGTTGTATGC GTGCCGGAGGATTTGATG 1 64.7 S 4 215-224
ESTB100 a (TCG)6 CCACGGGCGAGGACGAGTA GGGTCCTTCTTCGCCTCGTG 1 64.7 S 13 240-278
ESTB118 a (TTC)6 CTTGGCTAGGGTTTCTTGAGTCGT CATGGCTTTTGGCTTGCTTCT 1 61.0 S 5 106-163
ESTB189 b (TCA)10 GTAAGGAAGAAGCAACAAACAACAG GATTCGATGCAACTCTCCTGTAAA 1 60.0 S 5 261-280
ESTB191 b (GCT)5 GCGCCATCAGGGAAGCCAAAAC GCGCGTGCGAGCAGATGAAC 1 60.0 S 5 213-226
ESTC80 a (ATTC)3 ATTCTTTCTCCCCCTGTTGTGC GTCGCCAGATCGCTTTCGTT 1 58.9 S 7 188-292
CV06 c (AATT)13 TCTCAAGCTTCGCCAGCTA TGGCTCGGCTGTAGGAATTA 2 60.0 S 3 188-230
CV11 c (GAA)6 TGGCATGTGTCATAGCCAAT CCCCAACTGGGACTTTTACA 2 60.0 S 6 227-242
CV22 c (AGGG)5 CACTACTCGCCCCGATTTC CGAGTGCTTCTCCATCTGC 2 64.0 F 8 140-166
CV23 c (GGAA)7/(AGG)6 GAACTGCTCACTGGCTCCTC GTAGAAGTCCGTCGCCGTAA 2 64.0 F 9 150-206
CV24 c (CCAA)5/(CACCT)4 TCGGAGAAGTTGACCGAGTT GGTTTAGAGTTGGGGCCTTC 2 60.0 F 7 187-205
CV29 d (ATCT)14 TCGCGTCCACCAATGTAACC GCGTGCATCGCTTGTGTCTT 2 64.0 F 10 85-133
CV37 d (TTTC)15 GGATGGACGACGTGTCCTGG ATAAAGTGGCCGCTTGGATTGA 2 64.0 F 6 117-155
CV38 d (CTTTT)18 GAAGCAGGGGCCTCAAGTTG GTCAAACAGGCGATCTGGCTC 2 64.0 F 9 109-199
CV46 c (GGTAA)11 TGTTCCAAGTTCATGCGCTCC ATGCATGCAGGTTCAAAAGCAG 2 64.0 F 5 146-188
CV51 c (TGT)13 CTACCCCAACTTGCTTGGGAC GACTGGAACAAAGACGGACTG 2 64.0 F 3 147-160
CV53 c (AAAAT)5/(TTTAT)6 CCCCACCGTAGCTTGTGCAT AAACGTGCACATGCTTGTATGC 2 64.0 F 7 160-183
CV58 c (ATAGAT)10 CGGGTAGTTAGGAGGAGATGG GTCATCCATTTTGGAACGAATGG 2 64.0 F 6 153-195
CV78 c (CTGTG)9 ACGAGGCCACCATAGAACATG GCAATTGGGAGGAGAGGAATG 2 64.0 F 9 144-203
CV79 c (CTATAT)11/(TATAGA)6 GGCACTGCTGGTGGTTGATTG TCCCACATCAAGAGGCAGCTA 2 64.0 F 7 136-197
CV86 c (AATT)8 CCTCAGCAGCCCAAAGTCCT GTCGGAATCAGCCGGATTAGC 2 64.0 F 5 159-187
CV91 c (GCC)6/(GCA)6 AAAGGAAATCGCCCTCCGTCT CCGATGATGAGCCAGCAATCC 2 64.0 F 8 175-197
CV94 c (AAAAAG)5/(CGT)5 GGCAGGCCAAGATGAATGAAG AGCACAGCGGAGGGTACGG 2 64.0 F 4 187-205
CV100 c (GAG)13 CTGTTGAGGAGCCGGATGAG CTCTTCCGATGGCTCGGTCT 2 64.0 F 9 222-256
CV101 c (ATC)23 GTCGTCGTCGTCACGATCATC AGTTGACGGCATGGTTCTTGC 2 64.0 F 11 111-180
CV104 c (TCCTG)5 GATTTTCGACTGTGCGCTTGG AAGTTCTCTGCCGGAGCAAAC 2 64.0 F 6 133-158
CV106 c (GGC)8 AAACAGAGCATACTCGAGGCC ACGTTGCTGACGAGGTTTTCC 2 64.0 F 6 146-161
CV115 c (TCACAG)10/(GTA)6/(AGA)5 GTCCATGTCCATCCATGATCC GGAGCTCCGTCTTCTTGTTAC 2 60.0 S 6 150-174
CV119 c (AAAAC)7 TATCTCTCCTTGGTTTGGATGG CACCCTACCAAATACCACAACA 2 64.0 F 5 121-175
CV128 c (GCA)13 AGGGCAACGGAGTCTTCGAC CTGAACTCCGATGTGCTGGTG 2 60.0 F 5 147-168
CV135 c (AAG)16 AGCAAAACCAGCCTTCCCTTC CTGTTTGTTTCTGCTTGCTTGC 2 64.0 F 6 129-159
CV144 c (TCTCCG)5 GCGCCTCCGTGGATAAGAATC CCTTCCCCTACAGCGCCTAC 2 64.0 F 5 146-164

a, b, c, d Develop by Oliveira et al.[72], Marconi et al.[73], CanaVialis (unpublished); Maccheroni et al.[74], respectively.

e PCR program as described in Material and Methods.

f Annealing temperature in the amplification reaction.

g D: Silver-stained polyacrylamide gel electrophoresis (S) or fluorescence-based automated capillary electrophoresis (F) for the detection of EST-SSR alleles.

h Observed number of alleles per locus and their size ranges in bp.

Palhares et al.

Palhares et al. BMC Genetics 2012 13:51   doi:10.1186/1471-2156-13-51

Open Data