Table 3

Name of tested genes, chromosomal localization, primer sequence and expected amplified DNA products

No.

Gene IDa

Chromosome

Sequences of the primers

Ta (°C)

Expected products (bp)

Gene size (bp)


1

TRI1 (FGSG_00071)

I

F

CACCAGTTTGCAGGATGT

53.2

850

1980

R

AATGGGAGTGATTAGTTCG

2

TRI5 (FGSG_03537)

II

F

TGGCGGATCTATCTATTCA

57.1

750

1129

R

CTTCTTGGCGTCCTCTGT

3

TRI6 (FGSG_1625)

II

F

ATGGAGGCCGAATCTCAC

54.4

600

673

R

CCACCCTGCTAAAGACCCT

4

TRI10 a (FGSG_03538)

II

F

ATTTCCCAAAGCCTAGACAA

54.2

700

1264

R

GGCCGTAATCTTCAAATGGT

5

TRI10 b (FGSG_03538)

II

F

GCACCATTTGAAGATTACGG

54.2

550

R

CGTCAAGTCTTCCCATCTCA

6

TRI14 (FGSG_03543)

II

F

AGCCCGAACCCGCTACAT

57.3

750

1116

R

CGAACCTGCTGCTCTTAC

7

MetAP1 (FGSG_01397)

I

F

AACGATGCCGGATCGTCA

55.3

800

1403

R

TTGCCAAACTCTCGGATCAA

8

Erf2 (FGSG_08531)

IV

F

AGGCATCTTTGTTGTTGTG

52.4

750

2040

R

TTGGTAATACGTGGGTTGT


a The given gene ID is the entry number of the MIPS F. graminearum genome database (FGDB; Wong et al. 2011)

Talas et al. BMC Genetics 2012 13:14   doi:10.1186/1471-2156-13-14

Open Data