Table 3

List of 1RS-specific ISBP markers

Marker

Left primer

Right primer

Annealing temp. (°C)


ora013

TGTTATATGAGCGCGAACCA

GCAGAAGTTGGGCGTGTACT

62

ora014

AACTCCGAATCGTTGGGATA

CCGTCGTCCCAAAATAGTGT

62

ora015

GCCGTCGTCTTCCTGAATAG

ACCAAGATGAGCACCAAACC

62

ora016

TCCGTCCCCGTCTCCGTC

ATAAGCCGTGCAAGTCGCC

62

ora017

TGACAAATTGGTTCGCAAGGGG

GCAGCCGTCCACAGACATATAG

62


Zhang et al. BMC Genetics 2011 12:42   doi:10.1186/1471-2156-12-42

Open Data