Table 3

Primers utilized for POMC genotyping and characterization of variants.

POMC target

Primer

Sequence (5' to 3')


POMC c.288C>T

Forward

GATGAGCAGCCGCTGACT

Reverse

GTCAGCTCCCTCTTGAATTCGAG

Anchor

GCTTCGGCCGTCGGAATGGT

Sensor

GCAGCAGCAGCGGAGTTG


12 bp deletion

Forward

CCGTCGGAATGGTAGCA

Reverse

CGTTGGGGTACACCTTC


cDNA

Forward

GCGACGGAAGAGAACGAAGGA

Reverse

TGATGGCGTTTTTGAACAGCGTGAC


Deobald and Buchanan BMC Genetics 2011 12:2   doi:10.1186/1471-2156-12-2

Open Data