Table 1

PCR primers (Sigma Aldrich, Castle Hill, Australia)

Name,

Binding site

Sequence

Usage


YB3 6FAM

DAT722 attC rev

GAATCMCTCTTRARYDSTTTGT

attC PCR

YB4 6FAM

DAT722 attC fwd

TCACMCCTTARYDSGGCGTTA

attC PCR,

Promoter isolation

MazG f

Cassette 21 ORF fwd

GTTATCTGAGTTACAAAGTC

Method validation, Promoter isolation

MazG r

Cassette 21 ORF rev

TCCTATCGGTTGTACTTAAC

Method validation, Promoter isolation

VhC 21f

Cassette 21 ORF fwd

TATGCGCCAGAGCAATCTGAACACTAT

Promoter isolation

VhC 21r

Cassette 21 ORF rev

CCGTGAATATTGGCTAGAGCACAAACA

Promoter isolation

VhC 89f

Cassette 89 ORF fwd

ATCAGAAATTGAAGACTTGC

Method validation

VhC 89r

Cassette 89 ORF rev

TGAGACATTACGCAGTTAAA

Method validation

VhC16f

Cassette 16 ORF fwd

AAAAGTCGCTCAGAAGAATA

Promoter isolation

VhC16r

Cassette 16 ORF rev

GCATTACGGATACTTGTCTT

Promoter isolation

VhC17f

Cassette 17 ORF fwd

ACTGGTCAAAATACAACCAT

Promoter isolation

VhC17r

Cassette 17 ORF rev

TACAACATCGAGCTAACAAA

Promoter isolation

VhC18f

Cassette 18 ORF fwd

GGTTTGATAGTTACGCTGAT

Promoter isolation

VhC18r

Cassette 18 ORF rev

CAACCAAATGTGATAATGAA

Promoter isolation

VhC19f

Cassette 19 ORF fwd

GAGTGCAGCAGGTTATTTAT

Promoter isolation

VhC19r

Cassette 19 ORF rev

ATACTGACCGATAACTTTGG

Promoter isolation


Michael and Labbate BMC Genetics 2010 11:82   doi:10.1186/1471-2156-11-82

Open Data