Table 2

Variable sites of the aligned sequences of three chloroplast DNA fragments in 32 haplotypes of Scutellaria baicalensis and 2 haplotypes of Scutellaria rehderiana.

Haplotype

Nucleotide position


atpB-rbcL

trnL-trnF

psbA-trnH


60

193

195

202

203

214

310

381

503

507

603

656

723

22

177

264

265

463

484

726

48

73

151

188

212

236

260

295

326

366

379

435

447

451


HapA

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

A

-

-

C

C

C

G

-

-

-

-

-

-

-

G

§

-

T

A

HapB

C

C

T

T

-

-

G

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

HapC

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

A

HapD

C

C

T

T

-

-

C

G

A

C

T

G

G

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

HapE

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

-

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

A

HapF

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

A

G

§

-

T

T

HapG

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

HapH

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

A

G

§

-

T

T

HapI

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

A

§

-

T

T

hapJ

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

A

G

§

-

T

T

HapK

C

C

T

T

-

-

C

G

C

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

A

HapL

C

C

T

T

-

-

G

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

A

§

-

T

T

HapM

C

C

T

T

-

-

G

G

A

C

T

G

T

-

-

-

-

-

A

A

C

G

-

-

-

-

-

-

A

G

§

-

G

T

HapN

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

A

-

A

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

HapO

C

C

T

T

-

-

G

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

HapP

C

C

T

T

-

-

C

G

A

C

T

G

T

-

T

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

HapQ

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

G

T

HapR

C

C

T

T

-

T

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

A

HapS

C

C

T

T

-

-

G

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

A

HapT

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

-

-

-

A

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

HapU

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

#

-

-

-

-

-

A

G

§

-

T

T

HapV

C

C

T

-

-

-

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

HapW

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

-

-

-

A

A

C

G

-

-

-

-

-

-

A

G

§

-

G

T

HapX

C

C

T

T

-

-

G

G

A

C

T

G

T

-

-

-

-

-

A

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

HapY

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

-

-

-

A

A

C

G

-

-

-

-

-

-

A

A

§

-

T

T

HapZ1

T

C

C

T

-

T

C

A

A

T

C

A

T

-

-

-

-

-

A

A

C

T

-

-

-

-

-

-

A

G

-

£

G

T

HapZ2

T

C

C

T

-

T

C

A

A

T

C

A

T

-

-

A

-

-

C

A

C

T

-

-

-

-

-

-

A

G

-

£

G

T

Hap1

C

C

T

T

-

-

C

G

A

C

T

G

T

-

-

A

A

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

Hap2

C

T

T

T

-

-

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

Hap3

C

C

T

T

-

-

G

G

A

C

T

G

T

-

-

A

-

-

C

A

T

G

-

-

-

-

-

-

A

G

§

-

T

T

Hap4

C

C

T

T

-

-

G

G

A

C

T

G

T

*

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

G

§

-

T

T

Hap5

C

C

T

T

-

-

C

G

A

C

T

G

T

*

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

A

§

-

T

T

Hap6

C

C

T

T

T

-

C

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

-

A

A

§

-

T

T

Hap7

C

C

T

T

-

-

G

G

A

C

T

G

T

-

-

A

-

-

C

A

C

G

-

-

-

-

-

A

G

§

-

T

T


HapA-Y and Hap1-7 are haplotypes of Scutellaria baicalensis; HapZ1-Z2 are haplotypes of Scutellaria rehderiana.

*: CTGAAAAC; #: TTAGTAGTCTTTC; ¶: CTAGACTTATTTCTTTCCATTAAG;

‡: TTCCATTAAGAATAAATAAAG; §: AAAATT; £: GAAAAAAATA.

Yuan et al. BMC Genetics 2010 11:29   doi:10.1186/1471-2156-11-29

Open Data