Table 1

Basic information for three self-developed InDel markers

Markers

Physical location

Prod. size*

Anneal temperature

Primers


Forward (5'-3')

Reverse (5'-3')


RID76

28.303 Mb

149

58°C

caccgaagactgatcagcaa

tcacattcgagtggagcaac

RID710

28.420 Mb

170

58°C

catgttatcgtgtgggcttt

tctgttgctgcagctgaact

RID711

28.482 Mb

138

58°C

gcacatgcatgctaggacat

agccggtaaatttcttgcac


*Production size in bp was predicted from the sequence of japonica variety Nipponbare.

Bai et al. BMC Genetics 2010 11:16   doi:10.1186/1471-2156-11-16

Open Data