Whole genome surveys of rice, maize and sorghum reveal multiple horizontal transfers of the LTR-retrotransposon Route66 in Poaceae
-
* Corresponding author: Olivier Panaud panaud@univ-perp.fr
- Equal contributors
1 Laboratoire Génome et Développement des Plantes, UMR CNRS/IRD/UPVD, Université de Perpignan, 52, avenue Paul Alduy, 66860 Perpignan, cedex, France
2 Centre de Coopération International en Recherche Agronomique pour le Developpement (CIRAD), UMR1096, Avenue Agropolis, 34398 Montpellier, Cedex 5, France
3 UMR de Génétique Végétale, INRA UPS INA-PG CNRS, Ferme du Moulon, 91190 Gif-sur-Yvette, France
BMC Evolutionary Biology 2009, 9:58 doi:10.1186/1471-2148-9-58
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2148/9/58
| Received: | 10 September 2008 |
| Accepted: | 16 March 2009 |
| Published: | 16 March 2009 |
© 2009 Roulin et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
Horizontal transfers (HTs) refer to the transmission of genetic material between phylogenetically distant species. Although most of the cases of HTs described so far concern genes, there is increasing evidence that some involve transposable elements (TEs) in Eukaryotes. The availability of the full genome sequence of two cereal species, (i.e. rice and Sorghum), as well as the partial genome sequence of maize, provides the opportunity to carry out genome-wide searches for TE-HTs in Poaceae.
Results
We have identified an LTR-retrotransposon, that we named Route66, with more than 95% sequence identity between rice and Sorghum. Using a combination of in silico and molecular approaches, we are able to present a substantial phylogenetic evidence that Route66 has been transferred horizontally between Panicoideae and several species of the genus Oryza. In addition, we show that it has remained active after these transfers.
Conclusion
This study constitutes a new case of HTs for an LTR-retrotransposon and we strongly believe that this mechanism could play a major role in the life cycle of transposable elements. We therefore propose to integrate classe I elements into the previous model of transposable element evolution through horizontal transfers.
Background
Horizontal Transfers (HTs) are defined as the transmission of genetic information between reproductively isolated species. Contrasting with vertical transmission (i.e. from parents to their progeny), this process has for a long time been considered as an unusual phenomenon. However, many studies have shown that HTs are frequent among prokaryotes and that they widely contribute to lineage evolution by acquisition of new genes [1,2]. Several recent reports have shown that gene flow can also occur between reproductively isolated eukaryotic species through HTs. These can involve genes [3-6] as well as transposable elements [7-9].
Transposable elements (TEs) are mobile DNA sequences which have the capacity to move from one location to another in their host genome. They are divided into two classes according to their mode of transposition (see [10], for the most recent review). Class I, or retrotransposons, transpose through a "copy and paste" mechanism. After their transcription, the RNA is reverse transcribed and integrated into the genome, leading to the duplication of the original copy. Retrotransposons can in some cases rapidly increase their copy number. In plants, it has been shown that these elements, notably the Long Terminal Repeat (LTR)-retrotransposons, are the main cause of genome size increase in the genus Oryza [11], in cotton [12] or in maize [13], beside polyploidy. Class II elements, or transposons, transpose through a "cut and paste" mechanism. These elements are excised and reintegrated elsewhere in the genome.
Because TEs from both class I and II can be found as free molecules (either RNA or DNA) during at least one step of the transposition cycle, they are considered to be more prone to HTs than other genomic sequences. In animals, many studies have shown that TEs can move between distantly related species, as for the genus Drosophila [14] where the P-element invasion constitutes one of the best described cases of HT in eukaryotes [7,15,16]. In plants, only two studies have described TE HTs, the first concerning the transfer of a Mu-like element (transposon) between foxtail millet (Setaria italica) and rice (Oryza sativa) [8] and the second involving multiple HT of a retrotransposon between seven species of the genus Oryza [9].
The scarcity of cases of TE HTs in plants may be an indication that they are rare phenomena. Alternatively, it could only reflect the technical difficulties raised by their detection and correct characterization. In that case, one could anticipate that the recent accumulation of genomic resources through large scale genome sequencing projects will provide more opportunities to study HTs in eukaryotes. As an example, a large amount of genomic sequences is now available for cereals such as rice, Sorghum and maize. Since rice diverged from maize and Sorghum 50–70 Mya, it excludes the transfer of genetic information by hybridization between these species and makes them appropriate to study HTs following a comparative genomic approach. We previously demonstrated the multiple HT of a retrotransposon within the genus Oryza [9]. By combining genome-wide comparative genomic analyses and molecular approaches, we present phylogenetic evidence of the HT of an LTR-retrotransposon, Route66, from a sugarcane relative to several rice species. Based on the accumulation of evidence of the occurrence of TE-HTs in eukaryotes, we also propose to include LTR-RTs in a general model of TE-mediated plant genome evolution.
Results
Route66 characterization
In a previous study [17], we identified Route66, an LTR-retrotransposon which is found in two copies in the genome of the cultivated rice species, Oryza sativa ssp. Japonica. One is located on chromosome 2 (nt 1 767 933 to nt 1 772 818, referred to hereafter as Osj2) and the other on chromosome 6 (nt 25 706 265 to nt 25 701 456, referred to hereafter as Osj1). Route66 is a 4,890 bp long LTR-retrotransposon with short 203 bp LTRs. In addition, only one copy of Route66 is found in the genome of the indica-type variety 93–11. The copy of Route66 of Oryza sativa ssp. japonica located on chromosome 2 is 99.5% identical to that of indica. Dot plot analyses (Figure 1) show that the japonica and indica sub-species share the insertion of Route66 on chromosome 2, which implies that either this insertion predates the radiation of the two subspecies or that it was introgressed from one subspecies into the other.
Figure 1. Dot plot analysis. Horizontal: O. sativa ssp. japonica. Vertical: O. sativa ssp. indica. The red square corresponds to Route66 sequence. Left border of Route66 is highly conserved between indica and japonica.
The structural annotation of Route66 confirmed that it is a complete element in rice, i.e. that it harbors all the features required for its mobility: LTRs, PBS, PPT and a complete gag-pol Open Reading Frame (Figure 2). In addition, the sequence identity observed between both copies of O. sativa ssp. Japonica is 99.4% (Table 1). Using a substitution rate of 1,3 × 10-8 mutation/site/year [18], we estimated that Route66 has been active in rice in the last 230,000 years.
Figure 2. Rice Route66 complete element using Artemis and Pfam annotation. The gag and pol regions are shown. The red line represents the the 1 kb cloned fragment in the different
species.
Table 1. Route66 sequence identity and Ka/Ks values.
Route66 as a new candidate for Horizontal Transfers
In silico detection
In order to investigate the possible origin and the evolution of Route66 in grasses, we looked for its presence in either the maize or the Sorghum genomes. We mined 12 additional complete copies of the element from maize and 5 from Sorghum. For each species, the copies of Route66 exhibit a high sequence identity, suggesting that they have been active recently in these genomes (Additional file 1). Surprisingly, the rice Route66 copies display more than 95% sequence identity with those found in Sorghum bicolor, which is unexpected given the date of their radiation, i.e. more than 50 Mya [19]. Moreover, this value is higher than that observed between the maize and Sorghum copies of Route66 (i.e. 91% on average), although these two species diverged only 12 Mya [20](see Table 1 and Additional files 1 and 2 for detailed results and sequence alignments). We also compared these values with those for seven orthologous genes in rice, maize and Sorghum (Table 2). On average, these genes are 85% identical, which indicates that the Route66 LTR-retrotransposon is far more conserved between rice and Sorghum than these seven genes. We also studied the phylogenetic relationships between all the Route66 elements found in rice, Sorghum and maize genomes. The phenetic tree (Figure 3B) clearly shows that the rice copies form a cluster with that of Sorghum. However, this result is incongruent with the species phylogenetic relationships established with known genes [21](Figure 3A).
Additional file 1. Sequence identity between all genomic copies of Route66. The data provided give the percentage of sequence identity between all genomic copies of Route66 identified in rice, Sorghum and maize.
Format: PDF Size: 18KB Download file
This file can be viewed with: Adobe Acrobat Reader
Additional file 2. Alignment of all genomic copies of Route66. The data provided give the alignment of all genomic copies of Route66 identified in rice, Sorghum and maize.
Format: ZIP Size: 17KB Download file
Figure 3. Phylogenetic analysis. A) Simplified species phylogeny adapted from [21] B) Route66 relationships between maize, Sorghum and rice. The tree was drawn using complete copies of Route66. C) Route66 relationship between maize, Sorghum, rice, sugarcane and their wild relatives and bamboo, based on the alignment of the
1 kb fragment. * represents sequences obtained by PCR cloning. Arrow shows sequences
responsible for the phylogenetic incongruence. Numbers indicate bootstrap values in
percent. Only the values higher than 80% were kept. Species abbreviations: zm: zea mays ssp. mays;zmm: zea mays ssp mexicana; zmp: zea mays ssp parviglumis; sb: Sorghum bicolor; sa: Sorghum arundinaceum; sp: Soghum propinquum; sd: Sorghum drummondii; sae: Sorghum aethiopicuum; sv: Sorghum virgatum. pa: Phyllostachis aurea; pb: Phyllostachis bisetii; sr: Saccharum robustum; soff: Saccharum officinarum; ssp: Saccharum spontaneum; osj:Oryza sativa japonica; osi: Oryza sativa indica; or: Oryza ridleyi; ol: Oryza longistaminata; oru: Oryza rufipogon.
Table 2. Interspecific sequence identities and Ka/Ks values for seven genes; size indicates the number of bp used for the computation.
Wet lab validation
In order to confirm the phylogenetic incongruence revealed by the Route66 sequences of rice, Sorghum and maize, we PCR amplified, cloned and sequenced 1 kb fragments of Route66 from various species of Oryza, Sorghum and Zea. We completed this analysis with the tentative cloning of Route66 homologs in bamboo, Saccharum, millets, wheat and Brachypodium. We then obtained additional sequences for three wild rice, three Saccharum, two bamboos, two teosintes and five wild Sorghum species. For each of the accessions of wild rice, Saccharum and Sorghum bicolor used in the study, we PCR amplified and cloned the Adh1 gene and compared the sequences obtained with that deposited in Genbank for the corresponding species. We therefore ruled out the possibility that our results were due to DNA contamination or mislabelling.
The phenetic tree obtained from the cloned sequences is given in figure 3C. This tree displays some phylogenetic incongruences, as in the case of that based on the in silico data above. Both Oryza and Phyllostachis genus (bamboo) sequences are embedded among Panicoideae whereas, according to the phylogeny of grasses, they should appear as outgroups (Figure 3A). All homologs cloned from Oryza species (O. sativa, O. rufipogon, O. longistaminata and O. ridleyi) form a clear cluster near the sugarcane accessions. Interestingly, O. sativa sequences show a 4.5% divergence with that of the wild sugarcane, Saccharum officinarum (see Additional file 3 for sequence identities). By using a substitution rate of 1,3 × 10-8 mutation/site/year [18], we estimate that this corresponds to a 1,5 My old radiation whereas both species diverged more than 50 Mya. Surprisingly, Phyllostachis sequences are only 9% divergent from the copies of maize and Sorghum orthologs which correspond to a 3,3 MY radiation whereas Bamboo and Panicoideae diverged 50 MYa.
Additional file 3. Sequence identity between all 1 kb fragments. The data provided give the percentage of sequence identity between all the 1 kb fragment of Route66 that we have sequenced.
Format: PDF Size: 21KB Download file
This file can be viewed with: Adobe Acrobat Reader
The subsequent cloning of Route66 in these additional species provided a better understanding of the origin of the HT. If the transfer was recent, it is expected that the copies of both the donor and the receiver species should exhibit a high sequence identity. As a consequence, they should appear in the same cluster in the phylogenetic tree. Route66 is 95.5% identical between rice and Saccharum officinarum, however the sequences of the genus Oryza are clustered near to, although not within, those of Saccharum. Further studies should be made to identify the species at the origin of the transfer. Nevertheless, we expect that this species should be phylogenetically close (or belong) to the Saccharum genus. A similar observation is made for the transfer involving Phyllostachis species. A larger sample of Poaceae taxa should be tested to infer more precisely the origin of these transfers.
Comparison of the evolutionary dynamics of Route66 with that of selected genes in rice, Sorghum and maize
For the seven genes mentioned above, we performed an interspecific non-synonymous to synonymous substitution ratio (Ka/Ks) analysis by comparing maize, Sorghum and rice orthologs. Table 2 shows that all the genes studied are submitted to purifying selection. All Ka/Ks ratio are lower than 0,3 (Table 2) and they all display similar interspecific sequence identities. We performed a similar analysis on Route66 and we observed that this element is under selective constraints when interspecific comparisons are performed (Table 1 and Additional file 4).
Additional file 4. Ka/Ks supplemental values. The data provided give the Ka/Ks values calculated between all genomic copies of Route66 identified in rice, Sorghum and maize.
Format: ZIP Size: 1KB Download file
Discussion
Evidence for horizontal transfer of Route66
Transposable elements are known to evolve faster than genes and are rapidly eliminated through unequal and illegitimate recombination [22-24]. Since rice and Sorghum diverged some 50–70 Mya [19,25,26], homologous retrotransposons are not expected to be found among these species or, at least, they should exhibit a very low sequence identity. On one hand, Route66 displays a high sequence identity (>95%) between rice and Sorghum throughout the element despite their radiation date (i.e. at least 50 MYa). On the other hand, Route66 is more conserved between these species than between Sorghum and maize (>91% whereas these two genera only diverged 12 MYa). This constitutes our first argument in favour of HT. Furthermore, Route66 is also more conserved between rice and Sorghum than genes which are under selective pressure (i.e. 85% sequence identity on average) and this constitutes the second and even stronger argument in favour of the HT.
However, two other mechanisms, i.e. strong selective pressure throughout the sequence of this element and the reduction of mutation rate in the region flanking the insertions could alternatively lead to the conservation of Route66 between rice, Sorghum and sugarcane.
TE domestication, defined as the co-option of TE-encoding proteins into functional host protein is one of the process which could be responsible for selective pressure on a TE sequence [27]. A number of studies have demonstrated that domestication is common in some animal genomes [27] and most of them involved a transposase-encoding sequence [28,29]. Through Ka/Ks analyses, we showed that Route66 has been subjected to purifying selection, which could be in accordance with a putative functional role of this element. However, this could also reflect the fact that non-functional TEs can not transpose and are rapidly eliminated from the genome through deletions, therefore inducing a bias in the Ka/Ks ratio. However, in the case of domestication, although the element evolves slowly, the topology of the phenetic tree obtained with Route66 should be similar to that obtained with the genes classically used for this purpose such as the waxy or phytochrome genes. This is clearly not the case as shown in Figures 3A, B and 3C since all sequences from the Oryza genus (genomic sequences as well as 1 kb fragments) are clustered with those of the Panicoideae (maize, Sorghum and sugarcane). They clearly cluster near the sugarcane sequences whereas, according to the phylogenetic relationship of these species, the Oryza genus is obviously out of the Panicoideae sub-family. This phylogenetic incongruence is thus in agreement with the sequence identities that were calculated. The high nucleotide sequence identity between rice and Sorghum concerns the whole element. No case of domestication of a complete element (including the non-coding LTR regions) has ever been demonstrated so far. For these reasons, we rule out the possibility of the domestication of the TEs.
An alternative explanation is that the elements could be inserted into a region with a reduced mutation rate. Our Ka/Ks survey for the genes flanking both insertions in O. sativa ssp. japonica showed that they are submitted to selective pressure but exhibit sequence identity similar to that of randomly chosen genes such as Waxy, Nod2 and Gid1 (Table 2). We therefore conclude that both insertion regions of Route66 in rice are not under a stronger selection than other parts of the genome.
Considering all these results and taking into account current knowledge on transposable element evolution, we propose that Route66 has been horizontally transferred into the rice genome. Moreover, we used sugarcane to estimate the age of the transfer. Sugarcane and rice copies harbour 95.5% identity (Additional file 3) therefore we estimate that the HT occurred recently, during the last million years. However, both sub-species, indica and japonica, share a common insertion on chromosome 2 (therefore inherited from their common ancestor, see Figure 1). Knowing that divergence between indica and japonica occurred during the last million years [30], these results tend to demonstrate that the transfer of Route66 occurred just before or concomitantly with the subspecies radiation. Moreover, the genome of O. sativa ssp japonica harbours one more copy than that of O. sativa ssp. indica. This indicates that Route66 has been active since the sub-speciation.
Evidence of multiple horizontal transfers
The sequences obtained for the wild rice species, O. rufipogon, O. longistaminata and O. ridleyi, are clustered with that of O. sativa. The wild rice copies are more than 98.5% identical to that of O. sativa, which is incongruent with the species radiation since, for example, O. sativa and O. ridleyi diverged 25 Mya. This data is therefore in agreement with the occurrence of a horizontal inheritance of Route66 in the genus Oryza. However, further studies should be made to test if the HT occured independently from the donor species to the four Oryza species or if the copy was first transferred to one rice species and then spread through the genus Oryza. Nevertheless, it was previously demonstrated that the LTR-retrotransposon RIRE1 has been horizontally transferred between seven wild rice species [9]. We therefore consider that Route66 could constitute a second example of multiple HTs in the genus Oryza.
We suspect that another HT of Route66 occured between a Panicoideae and Phyllostachis species. Phyllostachis sequences display more than 92% sequence identity with some sequence of maize and Sorghum. Moreover, Phyllostachis sequences are included in the cluster formed by the Route66 homologs from the Panicoideae species, although these sequences should be clearly separated according to the species radiation (Figure 3A). The hypothesis of HT in Phyllostachis is reinforced by the fact that Route66 was not found in the Triticeae. Even if we can not exclude that this absence is due to to a PCR bias, one explanation is that Route66 has not been vertically inherited in grasses although we can not rule out that the element was lost in the ancestor of the Poideae sub-family. This could be tested by the analysis of a larger sample of Pooideae species. The high conservation of Route66 between Phyllostachis and maize as well as the phylogenetic incongruences are unexpected and could be the result of a second HT of Route66 involving Bambusoideae. However, this needs to be ascertained by supplementary analyses.
Mechanisms involved in Horizontal Transfers
Based on what is known in both animals and plants, three main mechanisms have been invoked to explain HTs [31]. The first is a direct plant-to-plant transfer. This has been well described in the case of gene transfer between parasitic angiosperms and their hosts [3,32,33]. Direct plant-to-plant transfer was estimated to be responsible for 26 HTs of plant mitochondrial genes to Amborella [3]. Even if no case of direct plant-to-plant HTs has been reported yet for TEs, this process is likely to occur for any DNA sequence (either genes or TEs). In our case, no rice parasitic plants are known but we cannot exclude the possibility that such plants existed in the past and could have been at the origin of HTs.
An alternative hypothesis is transfer by hybridization and introgression. This hypothesis remains attractive since interspecific hybridization is a common process in plants, presumed to be at the origin of most allopolyploidization events. Many examples of introgressions have been described and are considered to be responsible for organellar gene transfers in plants [34]. However, this mechanism is only possible if the species are close enough to hybridize spontaneously, which is not the case for the Ehrhartoideae (rice) and Panicoideae.
Vector mediated transfers constitutes a third possible mechanism. This could explain HTs between distant species and many studies suggest that bacteria [35] or fungi [6] could be responsible for HTs. Only one example clearly demonstrated the transfer from a reptile to a virus, which constitutes a first step to a vector-mediated transfer [36]. One could suppose that the integration of a retroelement into a viral genome (or other vectors such as insects) could occur in the same way in plants. This could explain why, if several organisms share common parasites, some retrotransposons could be involved in multiple HTs. This still needs to be tested by further experiments to fully understand the mechanisms involved in HTs.
Transpositional activity of Route66 and potential impact on genome evolution
The two Route66 copies of O. sativa ssp. japonica are 99.4% identical. This indicates that Route66 has been active recently, i.e. during the last 230,000 years. In plants, few LTR retrotransposons are known to be still active. These are for example Tos17 in rice [37], Tnt1 in tobacco [38] or BARE1 in barley [39], whereas most TEs are silenced either by the methylation and/or the small RNA pathways [40,41]. As an example, the CAC1 element is transpositionaly activated when present in a ddm1 hypomethylation background in Arabidopsis [42]. Hirochika et al. have also demonstrated that Tto1, a tobacco TE, can transpose in a heterologous systems such as rice or Arabidopsis thaliana even if the copy number is positively correlated with DNA methylation, leading to rapid silencing of the element [43]. One could therefore propose that by invading a new genome a transferred element could escape epigenetic silencing and be active after its transfer. This could explain why 3,000 and 300 copies of the horizontally transferred copy of RIRE1 are now present in the O. minuta and O. granulata genomes respectively [9]. The activation process could favor the retention of the transferred copy in the new genome by decreasing the probability of its elimination by genetic drift [44] and could explain why several cases of TE-HTs have been described. In our case, Route66 has not undergone any burst of transposition because it is only present in two copies in the rice genome. However the transpositional activity of the transferred copies of Route66 possibly explains how it could have spread in several taxa of the grass family. More generally, the transpositional activity of transposable elements after their HTs could explain their evolutive success in eukaryotes lineages since it allows retrotransposons to persist after invasion of a new genome [45].
Conclusion
There is no doubt that TE HTs could play a role in genome and thus in species evolution by generating variability [46], since TEs are known to have an impact on genes [27,47] and on genome dynamics [11,24,48]. In addition, there is some evidence that horizontally transferred TEs could lead to structural and functional modifications in the recipient species. As an example, the P-element is responsible for genetic abnormalities such as high mutation rate, chromosome breakage or sterility in Drosophila melanogaster when crossing females lacking P-element and males harbouring more than 30 copies of this element [49,50]. Moreover, HTs often involve active elements (as for the P-element, RIRE1 or Route66) which could make them responsible for modification in both genome structure and gene expression. We therefore believe that HT of TEs could have an important impact on genome evolution.
TEs are highly dynamic sequences known to mutate rapidly. It is also commonly admitted that they can massively increase genome size through bursts of transpositional activity, as in the case of the wild rice species O. australiensis where three LTR-retrotransposons comprise 60% of the genome [11]. It is also well established that transposable elements are rapidly deleted from the genome [24,51]. These observations led some authors to propose the increase/decrease model for plant genome evolution [52] which postulates that bursts of transposition are rapidly counterbalanced by deletion. Based on the high rate of HTs involving mariner-like elements (MLES), it was further proposed that MLES could maintain themselves by horizontal transmission and thus counterbalance their elimination by stochastic loss and mutation [45,53]. Given the accumulation of the recent demonstrations of TE HTs, we propose to generalize this model of evolution to all classes of transposable elements. Horizontally transferred TEs can escape silencing and therefore transpose before they are deleted, increasing their chances of survival in their new host genome. HTs therefore allow TEs to colonize and invade new genomes by bursts of transposition as has been shown for RIRE1 in wild rice [9] or for the P-element in Drosophila melanogaster [7,15]. We propose that HTs may be a frequent process in the life cycle and evolution of TEs and that this phenomenon explains their persistence in the genomes of almost all eukaryotic genomes.
Methods
In silico analysis and identification of new candidate
We retrieved all rice retrotransposon sequences from the RetrOryza database (http://www.retroryza.org/ webcite[54]). These were used in a Blastn search against available maize and Sorghum sequences. Conserved Route66 genomic copies of rice, maize and Sorghum were aligned using CLUSTALX [55] and modified by hand using SEAVIEW software [56]. The final alignment was used to construct trees using neighbour-joining methods with PAUP software [57]. 10,000 bootstrap replicates were performed.
Route66 structural annotation
Annotation was performed using the Artemis software [58]. ORFs longer than 100 residues were automatically extracted from the element sequences. They were then scanned using a combination of Pfam, ProSite and Blastp analyses with standard parameters. The results were imported into Artemis in order to reconstruct the complete structure of each element. The LTRs were identified using Dotter [59] and the PBS and PPT were manually determined.
Ka/Ks analysis and estimation of gene selective constraints
Both insertions of Route66 were mapped in silico on the genome of O. sativa (IRGSP pseudomolecules build 4) using RAPDB Blast http://rapdb.dna.affrc.go.jp/ webcite. We retrieved each cDNA sequence with a flanking region spanning 1 Mb for each insertion (chromosomes 2 and 6). We found 78 and 115 cDNAs for chromosomes 2 and 6 respectively. These sequences were subsequently used as queries against the available sequences from the Sorghum bicolor genome. For the most significant Blastn hits, we used the phytozome web site http://www.phytozome.net/sorghum webcite to retrieve sequences corresponding to S. bicolor mRNA. These mRNA sequences were then used for a Blastn search against the NCBI database in order to retrieve orthologous sequences from maize. Finally, maize sequences were used as queries against the NCBI database to check that they correspond to the initial rice transcript flanking the Route66 insertion. We selected 2 genes for each region (AK072088 and AB055156 for chromosome 2 and AK072921 and AK070134.1 for chromosome 6) with orthologous sequences in rice, Sorghum and maize. These sequences were aligned using the method described above. Sequence identities and non-synonymous to synonymous substitution ratios (Ka/Ks) were calculated using DNAsp software [60]. The same analyses were carried out for three genes: Waxy (granule bound starch synthase), Nod26-like (membrane protein) and Gid1 (Gibberellin receptor) which are not located in the flanking regions of Route66 but are known to be functional in the three species. Inter-specific sequence identities of coding region were thus computed for these seven selected genes.
We performed the same analysis with all putatively functional Route66 copies (with no stop codon in the coding region) of rice, maize and Sorghum, except that sequence identities were computed on the entire sequence of Route66 (4,890 pb) including both LTR and coding regions (Figure 2). The observed divergence was translated into an insertion date using a substitution rate of 1,3 × 10-8 mutation/site/year [18].
Amplification, cloning and phenetic analysis
Total DNA was extracted from 12 rice species provided by the International Rice Research Institute, Manila, Philippines: Oryza. sativa, O. rufipogon (10591), O. longistaminata (acc.110 404), O. punctata (acc.105 690), O. officinalis (acc.101 116), O. minuta (acc. 105 089), O. alta (acc.105 143), O. australiensis (acc. 100 882), O. granulata (102 118), O brachyantha (acc. 101 232), O. ridleyi (100821) and O. coarctata (acc. 104 502). DNA from Panicum milliaceum and from two bamboo species, Phyllostachis bissetii and Phyllostachis aurea, was also extracted. DNA from Saccharum spontaneum, Saccharum officinarum and Saccharum robustum and from Sorghum bicolor, Sorghum aethiopicum, Sorghum arundinaceum, Sorghum drummondii, Sorghum propinquum and Sorghum virgatum were provided by the Center for International Co-operation in Agronomic Research for Development (CIRAD, Montpellier, France). DNA of Zea mays ssp mays (maize), ssp parviglumis and ssp mexicana (teosinte) was provided by the station de génétique végétale (Le Moulon, Gif-sur-Yvette, France). DNA of Triticum durum, Triticum monococum and Aegilops taushii was provided by the ENSAM (Montpellier, France). DNA from Brachypodium distachyon was provided by the Faculty of Engineering and Natural Science Sabanci University Orhanli (Tuzla-Istanbul, Turkey) and DNA of wheat was provided by the INRA (Montpellier, France).
We used previous genomic sequence alignment of Route66 to design primers for its PCR amplification (Forward primer: 5'ACGCCGGAGTAGACCTCGTT3', Reverse primer: 5'ATATGCCATCTGTGGATATCC3'). The amplification products were cloned in pGEM-T easy vector (Promega, http://www.promega.com/ webcite). Sequences were obtained from both 5' and 3' ends to give a contig of around 1 kb. Only one representative sequence was kept per species and these were aligned with the corresponding regions of maize, rice and Sorghum genomic copies. Alignment and tree construction were performed as described above. Inter-species sequence identities were then calculated.
Adh1 sequencing
In order to eliminate the possibility of DNA contamination, we amplified and sequenced Adh1 genes from O. sativa, O. rufipogon, O. longistaminata, O. ridleyi, in the three sugarcane species and in Sorghum bicolor. We used the primers designed by Ge et al. [61] to amplify the gene. For all the data obtained, we exclude that these results could be due to DNA contamination since we sequenced Adh1 gene for all the accessions we used in this study and confirmed that they correspond to the given species
Abbreviations
TEs: Transposable Elements; HTs: Horizontal Transfers.
Authors' contributions
AR carried out wet lab experiments, contributed to both In silico and phylogenetic analyses and to the writing of the manuscript. BP carried out the in silico analyses and contributed to the writing the manuscript. PMF performed the Ka/Ks and the phylogenetic analyses. FS performed the structural annotation. AD and DM contributed to biological sampling and data analysis. OP contributed to the writing of the manuscript and to the data analyses. All authors read and approved the final manuscript.
Acknowledgements
This work was supported by a PhD grant from the French ministry of education and from the CNRS. The authors thank Cristian Chaparro, Edna Galinato and Stéphane Cornet for their comments on the manuscript. They also thank Andrea Zuccolo for providing some information on the annotation of Route66 in the rice genome.
References
-
Koonin EV, Makarova KS, Aravind L: Horizontal gene transfer in prokaryotes: quantification and classification.
Annu Rev Microbiol 2001, 55:709-742. PubMed Abstract | Publisher Full Text
-
Lawrence JG: Horizontal and vertical gene transfer: the life history of pathogens. In Concepts in Bacterial Virulence. Edited by Russell W, Herwald H. Basel, Switzerland: Karger publishing; 2005:255-271.
-
Bergthorsson U, Richardson AO, Young GJ, Goertzen LR, Palmer JD: Massive horizontal transfer of mitochondrial genes from divers land plant donors to the basal angiosperm Amborella.
Proc Natl Acad Sci USA 2004, 101(51):17747-52. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Won H, Renner S: Horizontal gene transfer from flowering plant to Gnetum.
Proc Natl Acad Sci USA 2003, 100(19):10824-29. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Richardson AO, Palmer JD: Horizontal gene transfer in plants.
J Exp Bot 2007, 58(1):1-9. PubMed Abstract | Publisher Full Text
-
Shen Z, Denton M, Mutti N, Pappan K, Kanost MR, Reese JC, Reek GR: Polygalacturonase from Sitophilusoryzae: possible horizontal transfer of a pectinase gene from fungi to weevils.
J Insect Sci 2003, 3:24. PubMed Abstract | PubMed Central Full Text
-
Daniels SB, Peterson KR, Strausbaugh LD, Kidwell MG, Chovnick A: Evidence for horizontal transmission of the P transposable element between Drosophila species.
Genetics 1990, 124(2):339-355. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Diao X, Freeling M, Lisch D: Horizontal transfer of a plant transposon.
PLoS Biol 2006, 4(1):119-128. Publisher Full Text
-
Roulin A, Piégu B, Wing R, Panaud O: Evidence of multiple horizontal transfers of the long terminal repeat retrotransposon RIRE1 within the genus Oryza.
Plant J 2008, 53(6):950-959. PubMed Abstract | Publisher Full Text
-
Wicker T, Sabot F, Hua-Van A, Bennetzen JL, Capy P, Chaloub B, Flavell A, Leroy P, Morgante M, Panaud O, Paux E, SanMiguel P, Schulman AH: A unified classification system for eukaryotic transposable elements.
Nat Rev Genet 2007, 8(12):973-82. PubMed Abstract | Publisher Full Text
-
Piegu B, Guyot R, Picault N, Roulin A, Saniyal A, Kim H, Collura K, Brar DS, Jackson S, Wing RA, Panaud O: Doubling genome size without polyploidization: dynamics of retrotransposition-driven genomic expansions in Oryza australiensis, a wild relative of rice.
Genome Res 2006, 16(10):1262-1269. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Hawkins JS, Kim H, Nason RA, Wendel JF: Differential lineage-specific amplification of transposable elements is responsible for genome size variation in Gossypium.
Genome Res 2006, 16(10):1252-61. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
SanMiguel P, Tikhonov A, Jin YK, Motchoulskaia N, Zakharov D, Melake-Berhan A, Springer PS, Edwards KJ, Lee M, Avramova Z, Bennetzen JL: Nested retrotransposons in the intergenic regions of the maize genome.
Science 1996, 274(5288):765-768. PubMed Abstract | Publisher Full Text
-
Loreto EL, Carareto CM, Capy P: Revisiting horizontal transfer of transposable elements in Drosophila.
Heredity 2008, 100(6):545-54. PubMed Abstract | Publisher Full Text
-
Haring E, Hagemann S, Pinsker W: Ancient and recent invasions of drosophilids by P elements.
J Mol Evol 2000, 51(6):577-586. PubMed Abstract | Publisher Full Text
-
Silva JC, Kidwell MG: Horizontal transfer and selection in the evolution of P elements.
Mol Biol Evol 2000, 17(10):1542-57. PubMed Abstract | Publisher Full Text
-
Rice Annotation Project, et al.: The Rice Annotation Project Database (RAP-DB): 2008 update.
Nucleic Acids Res 2008, (36 Database):D1028-33. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Ma J, Bennetzen JL: Rapid recent growth and divergence of rice nuclear genomes.
Proc Natl Acad Sci USA 2003, 101(34):12404-12410. Publisher Full Text
-
Wolfe KH, Gouy M, Yang YW, Sharp PM, Li WH: Date of the monocot-dicot divergence estimated from chloroplast DNA sequence data.
Proc Natl Acad Sci 1989, 86(16):6201-6205. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Swigonova Z, Lai J, Ma J, Ramakrishna W, Llaca V, Bennetzen JL, Messing J: Close split of sorghum and maize genome progenitors.
Genome Res 2004, 14(10A):916-23. Publisher Full Text
-
Bouchenak-Khelladi Y, Salamin N, Savolainen V, Forest F, Bank M, Chase M, Hodkinson T: Large multi-gene phylogenetic trees of the grasses (Poaceae): Progress towards complete tribal and generic level sampling.
Mol Phylogenet Evol 2008, 47(2):488-505. PubMed Abstract | Publisher Full Text
-
Ma J, Devos KM, Bennetzen JL: Analyses of LTR-retrotransposon structures reveal recent and rapid genomic DNA loss in rice.
Genome Res 2004, 14(5):860-869. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Vitte C, Panaud O: Formation of solo-LTRs through unequal homologous recombination counterbalances amplifications of LTR retrotransposons in rice Oryza sativa L.
Mol Biol Evol 2003, 20(4):528-540. PubMed Abstract | Publisher Full Text
-
Vitte C, Panaud O, Quesneville H: LTR retrotransposons in rice (Oryza sativa, L.): recent burst amplifications followed by rapid DNA loss.
BMC Genomics 2007, 8:218. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
-
Kellogg EA: Relationships of cereal crops and other grasses.
Proc Natl Acad Sci USA 1998, 95(5):2005-10. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Paterson AH, Bowers JE, Chapman BA: Ancient polyploidization predating divergence of the cereals, and its consequences for comparative genomics.
Proc Natl Acad Sci USA 2004, 101(26):9903-9908. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Feschotte C: Transposable element and the evolution of regulatory networks.
Nat Rev Genet 2008, 9(5):397-405. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Muehlbauer GJ, Bhau BS, Syed NH, Heinen S, Cho S, Marshall D, Pateyron S, Buisine N, Chalhoub B, Flavell AJ: A hAT superfamily transposase recruited by the cereal grass genome.
Mol Gen Genomics 2006, 275(6):553-563. Publisher Full Text
-
Casola C, Lawing AM, Betran E, Feshotte C: PIF-like transposons are common in drosophila and have been repeatedly domesticated to generate new host genes.
Mol Biol Evol 2007, 24(8):1872-1888. PubMed Abstract | Publisher Full Text
-
Vitte C, Ishii T, Lamy F, Brar DS, Panaud O: Genomic paleontology provides evidence for two distinct origins of asian rice (Oryza sativa L).
Mol Genet Genomics 2004, 272(5):504-511. PubMed Abstract | Publisher Full Text
-
Fortune P, Roulin A, Panaud O: Horizontal transfer of transposable elements in plants.
-
Davis CC, Wurdack KJ: Host-to-parasite gene transfer in flowering plants: phylogenetic evidence from Malpighiales.
Science 2004, 305(5684):676-678. PubMed Abstract | Publisher Full Text
-
Mower JP, Stefanovic S, Young GJ, Palmer JD: Plant genetics: gene transfer from parasitic to host plants.
Nature 2004, 432(7014):165-166. PubMed Abstract | Publisher Full Text
-
Rieseberg LH, Soltis DE: Phylogenetic consequences of cytoplasmic gene flow in plants.
-
Kondo N, Nikoh N, Ijichi N, Shimada M, Fukatsu T: Genome fragment of Wolbachia endosymbiont transferred to X chromosome of host insect.
Proc Natl Acad Sci USA 2002, 99(22):14280-285. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Piskurek O, Okada N: Poxviruses as possible vectors for horizontal transfer of retroposons from reptile to mammals.
Proc Natl Acad Sci USA 2007, 104(29):12046-51. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Hirochika H, Sugimoto K, Otsuki Y, Tsugawa H, Kanda M: Retrotransposons of rice involved in mutations induced by tissue culture.
Proc Natl Acad Sci USA 1996, 93(23):7783-7788. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Grandbastien MA, Spielmann A, Caboche M: Tnt1, a mobile retroviral-like transposable element of tobacco isolated by plant cell genetics.
Nature 1989, 337(6205):376-80. PubMed Abstract | Publisher Full Text
-
Kalendar E, Tanskanen J, Immonen S, Nevo E, Schulman AH: Genome evolution of wild barley (Hordeum spontaneum) by BARE-1 retrotransposon dynamics in response to sharp microclimatic divergence.
Proc Natl Acad Sci USA 2000, 97(12):6603-6607. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Okamoto H, Hirochika H: Silencing of transposable elements in plants.
Trends Plant Sci 2001, 6(11):527-534. PubMed Abstract | Publisher Full Text
-
Singer T, Yordan C, Martienssen RA: Robertson's Mutator transposons in A. thaliana are regulated by the chromatin-remodeling gene decrease in DNA Methylation (DDM1).
Genes Dev 2001, 15(5):591-602. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Miura A, Yonebayashi S, Watanabe K, Toyama T, Shimadak H, Kakutani T: Mobilization of transposons by a mutation abolishing full DNA methylation in Arabidopsis.
Nature 2001, 411(6834):412-414. Publisher Full Text
-
Hirochika H, Okamoto H, Kakutani T: Silencing of retrotransposons in Arabidopsis and reactivation by the ddm1 mutation.
Plant Cell 2000, 12(3):357-368. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Le Rouzic A, Capy P: The first steps of transposable elements invasion: parasitic strategy vs. genetic drift.
Genetics 2005, 169(2):1033-1043. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Hartl DL, Lohe AR, Lozovskaya ER: Modern thoughts on an ancyent Marinere: Function, Evolution, regulation.
Annu Rev Genet 1997, 31:337-358. PubMed Abstract | Publisher Full Text
-
Kidwell MG: Lateral transfer in natural populations of eukaryotes.
Annu Rev Genet 1993, 27:235-256. PubMed Abstract | Publisher Full Text
-
Kashkush K, Feldman M, Levy AA: Transcriptional activation of retrotransposons alters the expression of adjacent genes in wheat.
Nature genetics 2003, 33(1):102-106. PubMed Abstract | Publisher Full Text
-
Vitte C, Bennetzen JF: Analysis of retrotransposon structural diversity uncovers properties and propensities in angiosperm genome evolution.
Proc Natl Acad Sci USA 2006, 103(47):17638-43. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Kidwell MG, Kidwell JF, Sved JA: Hybrid dysgenesis in drosophila melanogaster: a syndrome of aberrant traits including mutation, sterility and male recombination.
Genetics 1977, 86(4):813-833. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Ronseray S, Lehmann M, Nouaud D, Anxolabéhère D: P element regulation and X-chromosome subtelomeric heterochromatin in Drosophila melanogaster.
Genetica 1997, 100(1–3):95-107. PubMed Abstract | Publisher Full Text
-
Shirasu K, Schulman A, Lahaye T, Schulze-Lefert P: A contiguous 66-kb Barley DNA sequence provides evidence for reversible genome expansion.
Genome Res 2000, 10(7):908-915. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Vitte C, Panaud O: LTR retrotransposons and flowering plant genome size: emergence of the increase/decrease model.
Cytogenet Genom Res 2005, 110(1–4):91-107. Publisher Full Text
-
Lohe AR, Moriyama EN, Lidholm DA, Hartl DL: Horizontal transmission, Vertical inactivation, and Stochastic Loss of Mariner-like transposable elements.
Mol Biol Evol 1995, 12(1):62-72. PubMed Abstract | Publisher Full Text
-
Chaparro C, Guyot R, Zuccolo A, Piegu B, Panaud O: RetrOryza: a database of the rice LTR-retrotransposons.
Nucleic Acids Res 2007, (35 database):D66-70. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: The clustal_x windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res 1997, 25(24):4876-82. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Galtier N, Gouy M, Gautier C: Seaview and phylo_win: two graphic tools for sequence alignment and molecular phylogeny.
Comput Appl Biosci 1996, 12(6):543-548. PubMed Abstract
-
Swofford DL: PAUP. Phylogenetic Analysis Using Parsimony (and Other Methods). In Version 4. Sinauer Associates, Sunderland, Massachusetts; 2003.
-
Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream MA, Barrell B: Artemis: sequence visualization and annotation.
Bioinformatics 2000, 16(10):944-5. PubMed Abstract | Publisher Full Text
-
Sonnhammer EL, Durbin R: A dot-matrix program with dynamic threshold control suited for genomic DNA and protein sequence analysis.
Gene 1995, 167(3):GC1-10. PubMed Abstract | Publisher Full Text
-
Rozas J, Sánchez-DelBarrio JC, Messeguer X, Rozas R: DNA polymorphism analyses by the coalescent and other methods.
Bioinformatics 2003, 9(18):2496-2497. Publisher Full Text
-
Ge S, Sang T, Lu BR, Hong DY: Phylogeny of rice genomes with emphasis on origins of allotetraploid species.
Proc Natl Acad Sci USA 1999, 96(25):14400-5. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
