Table 2

Primers used in this study.

Gene

Primer

Sequence (5'-3')1

Source, if not this study


arginine kinase

akF

GCTTCAAGAAGACCGACAAGCAC

akF2

AAGACCTTCCTGGTCTGGTGC

akR

ACCCWKCTGCATSGAGATGATG

akR2

GCCATCGTACATCTCCTTGACG

CAD

581F3

AAYCCIAAYATYGCIACIGTICARAC

806F

GTNGTNAARATGCCNMGNTGGGA

[23]

843R

GCYTTYTGRAANGCYTCYTCRAA

[23]

1098R2

CAICCIACIGCRCACCARTCRAAYTC

Catalase

catF1

ACTTYGACCGKGAGCGIATTCC

catF2

GGTTTCGCYSTSAARTTCTACAC

catF3

GAYGGYTWYCGITTCATGAACG

catR1

GCCYTGRTYIGWYTTGAAGTGGAAC

catR2

GAASGARTTSGGRWAGTAGTTSG

catR3

GRCGKCCRAARTCRGCATCAAC

Enolase

enoF

ATGCAGGAGTTCATGATCCTG

enoF2

GTACGATCTGGACTTCAAGAAC

enoR

TCCTGGTCRAAGGGATCCTC

enoR2

AGRATYTGGTTGTACTTGGC

hunchback

hbF

ACICCICCIATGGAYGTIACICCICC

hbF2

TGYCCIAARTGYCCITTYGTIACIG

hbR

TGRCARTAYTTIGTIGCRTARTTRC

hbR2

GCYTGYTGRTCIGCRAACATYTGRA

white

WZ2E

(E)AAYTAYAAYCCIGCIGAYTTYTA

[65]

WZ2kr

AYTAYAAYCCIGCIGAYTTYTAYG

WZ4E

(E)GGIGTIATGAAYATHAAYGG

[65]

WZ4kr

GAYGGIGTIATGAAYATHAAYGG

WZ7X

(X)TCRAAIACRTTYTCRAAIGTCATR

[53]

WZ7kr

GCRAAIACRTTYTGRAAIGTC

WZ11X

(X)TTIARRAARAAICCICCRAA

[65]

WZ13kr

GCYTCRTTIGCRTAICKRAACC


1Degeneracy indicated by the IUB code; I is inosine; linkers (in parentheses) are X, an XbaI linker: CGTCTAGA, and E, an EcoRI linker: GGAATTC.

Reidenbach et al. BMC Evolutionary Biology 2009 9:298   doi:10.1186/1471-2148-9-298

Open Data