Table 1

Information on the genes and sequences of the primers used in the study.

Gene

Locationa

Enzyme

Aligned coding length (bp)

GC (GC3)b

ENCb

Primer sequencesc


CPS1

2

ent-copalyl diphosphate synthases I

1002

0.462 (0.494)

54.6

F1: AACTTGTGGAGGTTAGCAG

F2: TGTGGAGGYTAGCRGAGG

R1: AAGTCGCTCAGAGGCACG

R2: TAGCCCATGCAAGTCGCTC

KS1

4

ent-kaurene synthase I

1023

0.426 (0.417)

52.8

F1: TGCTGAAGCTTCCAGTTTCC

F2: TCCAGTTTCCGTGAATCAC

R1: CTTGCACATCTTCCAGAAC

R2: CCTTGACGACTGCATTCAC

KO2

6

ent-kaurene oxidase II

1050

0.514 (0.639)

58.2

F: CTGTAGTTGTGCTCAATTC

R1: GCCATCGTCTTGTACATGTC

R2: TCAGCCTCCACYCGAACTC

KAO

6

ent-kaurenoic acid oxidase

1053

0.603 (0.820)

39.2

F: CAGGACGTTCATGTTCAGCAG

R1: TCGTCGCCAAGCAGTTGTC

R2: GCCAAGCAGTTGTCCAC

GA20ox2

1

GA20-oxidase II

597

0.714 (0.966)

30.1

F: ATCCCGGAGCCATTCGTSTG

R: TGAAGGTGTCGCCGATGTTG

GA3ox2

1

GA3-oxidase II

786

0.710 (0.965)

30.4

F1: ACCCGCTCTRCTTCGACTTC

F2: GGCGGGTGCCGGAGACGCACG

R: CCATGTACTCSGGCCACGTGAC

GA2ox4

5

GA2-oxidase IV

819

0.694 (0.926)

34.0

F: GAGCAGATCTCGCTGSTGAG

R1: CAGGCGGTTGTCGCYGAG

R2: AGGCGGGAGAGGTAGGCAG

Total

6330


aChromosomal locations in O. sativa.

bAverage of 8 Oryzeae species.

cLocations of the primers for each fragment are showed in Additional file 2. The internal primers were used for cycle sequencing are listed in Additional file 5.

Yang et al. BMC Evolutionary Biology 2009 9:206   doi:10.1186/1471-2148-9-206

Open Data