Table 1

Primers used in this study
Gene fragment Primer name Or.1 Sequence (5′- 3′) Reference PCR conditions
12S 12Sa F AAACTGGGATTAGATACCCCACTAT Kocher et al. (1989) 94º (5'); 94º (45"), 51º (45"), 72º (80") × 35; 72 (5')
12Sb R GAGGGTGACGGGCGGTGTGT Kocher et al. (1989)
L1.STENO F GGATTAGATACCCCACTATGC This study 94º (5'); 94º (45"), 52º (45")’, 72º (90") × 35; 72º (5')
H1.STENO1 R TGACGGGCGGTGTGTACG This study
16S 16Sa F CGCCTGTTTATCAAAAACAT Palumbi (1996) 94º (5'); 94º (45"), 51 (45"), 72 (80") × 35; 72º (5')
16Sb R CCGGTCTGAACTCAGATCACGT Palumbi (1996)
16SaST F ATCAAAAACATCGCCTTTAGC This study 94º (5'); 94º (45"), 57º (45"), 72º (70") × 35; 72º (5')
16SbST R CTGAACTCAGATCACGTAGGAC This study
C-mos FUF F TTTGGTTCKGTCTACAAGGCTAC Gamble et al. (2008) 94º (5'); 94º (30"), 55º (45"), 72º (70") × 35; 72º (10')
FUR R AGGGAACATCCAAAGTCTCCAAT Gamble et al. (2008)
G73_STENO F GCTGTAAAGCAGGTGAAGAAATGC This study 94º (5'); 94º (45"), 56º (45"), 72º (80") × 35; 72º (5')
G74_STENO R GAACATCCAAAGTCTCCAATCTTGC This study
G73.5_STENO F GCATTTGGACTTAAAACCTG This study
G708 R GCTACATCAGCTCTCCARCA Hugall et al. (2008)
RAG-2 RAG2-PY1-F F CCCTGAGTTTGGATGCTGTACTT Gamble et al. (2008) 94º (5'); 94º (45"), 55º (45"), 72º (70") × 35; 72º (5')
RAG2-PY1-R R AACTGCCTRTTGTCCCCTGGTAT Gamble et al. (2008)

List of primers used in the amplification and sequencing of gene fragments, with the corresponding source and PCR conditions.

1Orientation.

Metallinou et al.

Metallinou et al. BMC Evolutionary Biology 2012 12:258   doi:10.1186/1471-2148-12-258

Open Data