Table 1

Overview of PCR primers used for cellulase amplication from individual nematodes
  CD1 CD2
CD4            ENG2
B Primer sequence 5’→3’ * Primer sequence 5’→3’ *
Region PPYGQLS (CD1): Region WCQDV (CD4):
CD1aF ccIccItacggIcaattgtc CD4aR tccacRtcctgggacca
CD1bF ccIccItatggIcaattgtc CD4cR tccacAtcttggcacca
CD1cF ccIccItatggIcaattatc
CD1PraFa ccgccgtatgggcaa Region FVTEYG (ENG2):
CD1PraFb cctccctatggccaa ENG2 see e.g.[22] gtIccRtaYTcIgtIacRaa
CD1PraFc cgccgtatgggcaa
CD1MelF ctccatatgggcaattatctgt Region ISYLNWAISD (CD6):
Region LKCNWN (CD2): CD6PraFb tctcctacatcaactgggc
CD2aF ctcaaatgcaattggaacKc CD6aR gcccagttggcgtaIgaga
CD2bF ctcaaatgcaattggaatKc CD6bR gcccaIttggcRtaIgaaa
CD2cF cttaaatgcaIttggaatKc CD6cR gcccaIttgaIgtaMgaaa
CD2dF cttaaatgctIttggaatKc CD6dR gcccagttgaYgtaIgaga
Region YVIVDW (ENG1): CDGp8R gcccagttgaggtacgaa
ENG1 see e.g.[22] taYgtIatcgtIgaYtggca CD6PraRa cccagttggcgtagga
ENG1R tgccaRtcIacgatIacRta CD6MelR tgtttgagatagcccagttg

* I=inosine; K= g or t, M= a or c, R= a or g, Y= c or t. In bold: discriminative nucleotide position.

Conserved amino acid motives in GHF5 cellulases from plant parasitic nematodes residing in nematode Clade 12 (Holterman et al. 2006 [24]). Primer design was based on these motives, and all primers used in this study are listed bellow. A. The backbone sequence given below is derived from the predicted amino acid sequence of the potato cyst nematode (Globodera rostochiensis) cellulase Gr-eng-1 (GenBank AF004523), amino acid positions 18 – 324 (mainly catalytic domain). Underlined: part of signal peptide for secretion. B. Primer names and primer sequences.

Rybarczyk-Mydłowska et al.

Rybarczyk-Mydłowska et al. BMC Evolutionary Biology 2012 12:221   doi:10.1186/1471-2148-12-221

Open Data