Table 1

Primer sequences for MHC in the brown bear
Primer pair no. Primer name Primer sequence (5’-3’) Gene Amplicon size (bp)
1 1UNIex1L TCCTsCTGCTrCTsTCGG MHC class I, 1st exon 625
1UNIex4R GCCCAGCACCTCAGGGTG MHC class I, 4th exon
2 2DRBUNIex1L GAyryTGATGrTGCTGArC MHC class II DRB, 1st exon 343
2DRBUNIex3R CCAGGAGGkTGTGrTGCTGCA MHC class II DRB, 3rd exon
3 2DQAUNIex1L CCwsTGGArGTGAAGAsAT MHC class II DQA, 1st exon 255
2DQAUNIex3R AACACwGTsACCTCAGGAAC MHC class II DQA, 3rd exon
4 2DQBUNIex1L GGCTGAGGGCAGAGACTC MHC class II DQB, 1st exon 282
2DQBUNIex3R TGGAyGGGrAGATrGTCACTGT MHC class II DQB, 3rd exon
5 URS_1_F GCTCsCACTCCCTGAGGTAT MHC class I, 228
URS_1_R CCwCGCTCTGGTTGTAGTA 2nd exon
6 URS_DRB_F_3 TTCACCAACGGsACGGAGCGG MHC class II DRB, 192
URS_DRB_R CTTGTCGCyGCACCrkGAAGCT 2nd exon
7 URS_DQA_F CTGACCATGTTGCTTACTACGG MHC class II DQA, 202
URS_DQA_R CATTGGTAGCAGCGrTATAGTTGGA 2nd exon
8 URS_DQB_F AGGATTTCGTGCTCCAGyTTAAG MHC class II DQB, 224
URS_DQB_R CTCGCCGCTGCrGGATGArsCTG 2nd exon
9 URS_1_F CGTATCGCCTCCCTCGCGCCATCAG MHC class I, 2nd exon 228
xxxxxxGCTCSCACTCCCTGAGGTAT
URS_1_R CTATGCGCCTTGCCAGCCCGCTCAG
xxxxxxCCwCGCTCTGGTTGTAGTA
10 URS_DRB_F_3 CGTATCGCCTCCCTCGCGCCATCAG MHC class II DRB, 2nd exon 192
xxxxxxTTCACCAACGGsACGGAGCGG
URS_DRB_R CTATGCGCCTTGCCAGCCCGCTCAG
xxxxxxCTTGTCGCyGCACCrkGAAGCT

xxxxxx indicates the location of a 6-bp tag in the fusion primer sequences.

Kuduk et al.

Kuduk et al. BMC Evolutionary Biology 2012 12:197   doi:10.1186/1471-2148-12-197

Open Data