Table 1

Primer characteristics of the used microsatellite markers (* derived from [44])

Primer name

Linkage group

Position

Repeat

Forward primer

Reverse primer


Tca-3.19*

3

5940315

AAT

CCATTGCAGATTGTAGGGTGT

GTTTTTACAGCGCCGAACAT

LGIII2

3

6593045

AAT

CATCACTTGGGTGCTTTATCC

CAATACCTGAATGTGTGTGTGC

LGIII3

3

9169070

ATA

CACTATTTCCGCATATTGTTGC

TTATCCCTCTTTGGCAGACG

LGVI

6

9124774

TAA

CAAAGCACTCATGTACGAAACC

CCTCTTATTGACTTGTGTTATGACC

Tca-6.11*

6

5965031

AAT

TAGTCTGCCGGCTGGTAAGT

AGCGACCGACATTTGTGTTT

Tca-6.2*

6

3982475

A

TTTTTGTTGGGACACCCTGTA

TTGCGACGTATTTTCATTCG

Tca-7.2*

7

4598114

A

GCTCGATTGGTAGGTGTGGT

AAAGCCTTTCACCTCCATTCT

LGVII1

7

904671

AAT

TTGTCTCTTTCAGGCCAAGG

GCTGAAATACTGGTCTGAGATGC

LGVII2

7

5833915

ATT

AAGGCATGCTTTGGTTCC

TGAATGCCGAAGACTAGTATGG

Tca-10.1*

10

4582080

AAT

AAATTCTCGGCTTTTTGGGT

GAGCTGGCGGTTATATTGGA

LGX4

10

8139860

CGG

ATAGTTGCGCGCCTTTCG

ACATCACTGCGTCATGCTAGG


Kerstes et al. BMC Evolutionary Biology 2012 12:18   doi:10.1186/1471-2148-12-18

Open Data