Table 3

Targeted regions, primer sequences and approximate product length (bp) of PCR for primer pairs used to amplify six cpDNA regions of Norway spruce

Region (short name)

cpDNA region

Primer

Sequence (5' - 3')

Position in cpDNA of Pinus thunbergii NC_001631

Position in cpDNA of Picea sitchensis NC_011152

Fragment Length in P. abies (bp)


ndhCp-ndhKp (CK)

pseudogene

ndhK-for1

CACTTCAGTTCTTGTTGTTCC

66530→66550

66774→66794

136 bp

ndhC_ndhK-rev

TCGCCACAGAACCAACGATG

66666→66647

66910→66891

psbM-trnD (MD)

intergene spacer

psbM_trnD-f1

GTTCGAGTAACGGAATCTAAC

28004→28024

27925→27945

200 bp

psbM_trnD-rev1

CGAACGTCTTCTGGAGTAGC

28204→28185

28124→28105

Pt3024, ORF46b* (B)

microsatellite

B-for

GCTTATGGCATTGTTGATGT

30166→30185

30701→30720

212-216 bp

B-rev

TGGGCATTCTAGCTGTATTG

30387→30368

30941→30922

Pt15169, ORF84* (D)

microsatellite

D-for

CTTGGATGGAATAGCAGCC

15169→15187

15208→15226

124 bp

D-rev

GGAAGCGCATTAAGGTCATTA

15286→15266

15327→15307

trnT-trnL (TL)

intergene spacer

trnT_trnL-sp-f1

CTGAGCTAAGCAGGCTCAATGG

69189→69168

69573→69552

251 bp

trnT_trnL-sp-brev

GCATGTTATTATCCTCCCCTAG

68945→68967

69323→69344

trnL (Li)

Intron

trnL-intron-f2

GAACGCTCTATTTACACC

68497→68480

68884→68867

237 bp

trnL-intron-rev

ACACGTAGAATTGGACTCTATC

68261→68282

68648→68669

trnL-trnF (LF)

Intergene spacer

Aa_trnLF-for

GGTTCAAGTCCCTCTATCCC

68198→68179

?

186 bp

Aa_trnLF-rev

ACTGATCAACTCAACTTGTCATAAGATGG

68014→68042

68400→68428

matK-trnK (K2i)

intron

trnK2i-f1

GCCCTCGTTCATGAGAATAACC

3281→3302

3368→3389

204 bp

trnK2i-r1

CATGAGTCAGGAGAGCGATTGG

3477→3456

3573→3552


* cpDNA region names from Parducci et al. (2005); primers B and D are from Parducci et al. (2005); primers CK, MD, TL, Li, LF and K2i were designed specifically for this study

Magyari et al. BMC Evolutionary Biology 2011 11:66   doi:10.1186/1471-2148-11-66

Open Data