Table 1

Primer sequences.

CYC copy

Name

5' to 3'


Forward primer


CYC1

CYC1F

GACATKCTBGGATTCGARAAGGC


CYC2A

CYC2AF

AAAGATTTGGTMMDRTCCAATCT


CYC2Ba

CYC2BaF

GGTATACCCCATTTTCACATCTTAC


CYC2Bb

CYC2BbF

GTATACCCCATTTTCACATCTTACATCA


CYC3A

CYC3A

ATACATATGTATCCTTTAGCCAATACA


CYC3B

CYC3BF

GAAACATTTACCTGCAACCCA


Reverse primer


CYC1

CYC1R

GCTCTTTCTCTYGCYTTYGCCCT


CYC2A

CYC2AR

CGYGTGTTGYTACCGATCTCC


CYC2Ba &CYC2Bb

CYC2R

TCTTGCTCTTTCYCTYGCYTTYGCCCTA


CYC3A &CYC3B

CYC3R

TGCTCTTTCTCTCGCYTTCGCCCTAGC


Primer sequences used in this study.

Carlson et al. BMC Evolutionary Biology 2011 11:325   doi:10.1186/1471-2148-11-325

Open Data