Table 1

Primers used in sequencing the 17S and 5.8S region of ribosomal DNA in P. violaceum

Name

Sequence 5'-3'


Sandie_A

AACCTGGTTGATCCTGCCAGT


17S_r1

AGATAATACAAGCTGAACTA


17S_f2

GCTCGTAGTTGAAGTTTAAG


1340_r

TCGAGGTCTCGTCCGTTATC


17S_f3

CTAAGATATAGTAAGGATTG


17S_r3

ATGATCCATCCGCAGGTTCA


ITS_5.8_f1

ACGGTAAAGTTAACG GATCG


ITS_5.8_r1

ACTCTCACCCAAGTATAACT


ITS_5.8_f2

AAACTGCGATAATTCACTTG


ITS_5.8_r2

CCGTCTTCACTCGCCGTTAC


Kalla et al. BMC Evolutionary Biology 2011 11:31   doi:10.1186/1471-2148-11-31

Open Data