Table 2

Primers used for PCR amplification and sequencing in this study

Target region

Primer sequence (5'-3')


Adh

Long partial region

Adh1-F1:ATGTCTAATACTGCTGGTCA

Adh1-F2: TGATGTTTACTTCTGGGAGG

Adh1-R1: GATTGAATTGTGTTCTTTA

Adh1-R2: TGTGGATTATGCAACGAAGA

Adh2-F: TGTTGACTTCTGGGATGCCAA

Adh2-R: ATGCTAACGATGCACCGCAA

Internal primer

Adh1-F5: AGGAGAATGCAAGGACTGCGCT

Adh2-F5: CATTGCAAGTCTGAGGAAAG

reduced Adh1

Adh1-F2

Adh1-R3: CAAAATGGTAGATAGGCTT

Specific primers

spAdh1-F: TCTACCATTTTGTTGGGACT

spAdh1-R: AACGCTTCCTGTACATTCAA

spAdh2-F: GATTAATCACTTCCTCGGCA

spAdh2-R: TAATATAGCCGGTGCACTCT


LEAFY

Long partial

LFY-F: TGTCGGAGGAGCCAGTGCAA

LFY-R: GGCGTAGCAGTGCACATAGT

LFY1int2

LFY1-F: TGGACGTTCATCAATAAAGA

LFY1-R: AGTCGAACTAAATAGTTGAA

LFY2int2

LFY2-F: GTGGGCCCATTTCCTGTAGT

LFY2-R: GTTAAATCCGGTCAGATTAT

LFY2s

LFY2S-F: CTGTATTGACTATTTCTGTC


MLFY2-F: CGTACGCTTATTTCTACTGCA

LFY2-R


Actin

Partial

Pact-F: CCATCCAGGCTGTTCTCTC

Pact-R: GCAAGGTCCAGACGAAGG


Zheng et al. BMC Evolutionary Biology 2011 11:255   doi:10.1186/1471-2148-11-255

Open Data