Table 1

Primers used for amplification of Hox gene fragments

Target gene

Primer name

Sequence(5'-3')

AA sequences

PL* (bp)

Notes


Forward primers (located at homeobox region)

PG1-PG7

HoxF1

TNGARYTNGARAARGARTTYCA

LELEKEFH

125

universal for PG1-PG7

PG1-PG10

HoxF1N1

CARACNYTNGARYTNGARAARGARTT

QTLELEKEF

128

universal for PG1-PG10

HoxF1N2

CARGTNACNGARYTNGARAARGARTT

QLTELEKEF

128

universal for PG1-PG10

PG5-PG7

HoxF7S

CARACNTAYACNMGNTAYCARAC

QTYTRYQT

149

universal for PG5-PG7

PG8-PG10

HoxF8

TNGARAARGARTTYYTNTTYAA

LEKEFLFN

120

universal for PG8-PG10

HoxF8N

TNGARYTNGARAARGARTTYYT

LELEKEFL

125

universal for PG8-PG10

PG9-PG11

HoxF9

DSNMGNAARAARVGNTGYCCNTA

TRKKRCPY

164

universal for PG9-PG11

PG1

HoxF1S

AAYTTYACNACNAARCARYTNAC

NFTTKQLT

149

universal for PG1

PG2

HoxF2S

MGGACNGCNTAYACNAAYACNCA

RTAYTNTQ

152

specific for PG2

PG3

HoxF3S

GCNTAYACNAGYGCNCARYTNGT

AYTSAQLV

149

specific for PG3

HoxF3S1

MGVCCNMGVMGVBTNGARATGGC

RPRRVEMA

80

specific for PG3

PG4

HoxF4S

ACNGCNTAYACNMGNCARCARGT

TAYTRQQV

152

specific for PG4

PG5

HoxF5S

GGNAARMGSGCNMGSACNGC

GKRARTA

165

specific for A5, B5

HoxFC5

AARCGNTCYMGAACNAGYTAYAC

KRSRTSYT

160

specific for C5

PG8

HoxF8S

GARAARGARTTYYTNTTYAAYCC

EKEFLFNP

116

specific for PG8

PG9

HoxF9S

GARAARGARTTYYTNTTYAAYATG

EKEFLFNM

116

specific for PG9

PG10

HoxF10S

AARMGNTGYCCNTAYACNAARCA

KRCPYTKH

152

specific for PG10

PG11

HoxF11

GARYTNGARMGNGARTTYTTYTT

ELEREFFF

122

specific for PG11

PG12

HoxF12

DSNMGNAARAARVGNAARCCNTA

SRKKRKPY

164

specific for PG12

HoxF12C

AARCCNTAYTCNAARYTNCARAT

KPYSKLQL

149

specific for C12

HoxF12D

AARCCNTAYACNAARCARCARAT

KPYTKQQI

149

specific for D12

HoxF12N1

KCNMGVAARAARMGVAARCCSTA

SRKKRKPY

164

specific for PG12

HoxF12N2

KCNMGVAARAARMGVAARCCWTA

SRKKRKPY

164

specific for PG12

HoxF12N3

KCNMGVAARAARMGVAARACNTA

SRKKRKTY

164

specific for PG12

PG13

HoxF13A

GGNMGNAARAARMGNGTNCCNTA

GRKKRVPY

164

specific for PG13(A,C,D)

HoxF13B

GGNMGNAARAARMGNATHCCNTA

GRKKRIPY

164

specific for PG13(B)

HoxF13A1

CARYTRAARGARCTNGARMGNGARTA

QLKELEREY

128

specific for PG13(A)

HoxF13B1

CARYTRAARGARCTNGARAANGARTA

QLKELENEY

128

specific for PG13(B,C,D)

Reverse primers (located at homeobox region)

PG1-PG12

HoxR1

TTCATNCKNCKRTTYTGRAACCA

WFQNRRMK

--

universal for PG1-PG12

PG13

HoxR13

TTNACNCKNCKRTTYTGRAACCA

WFQNRRVK

--

specific for PG13

PG14

HoxR14

TCNGGNGTNAGRAANCGRTTYTC

ENRFLTPE

89

specific for PG14, used with HoxF13A/HoxF13B

Primers used for amplification of exon1 of Hox genes

PG1

HoxB1(5'E1)F

GACATASTRYCNAAAGGTTGTAG

5' UTR

590-630

forward primer for HoxB1

HoxB1(E1)R

TTAACYTTCATCCANTCRAANGT

TFDWMKVK

--

reverse primer for HoxB1

PG2

Hox2S(E1)F

GAATTYGAGMGRGARATHGGNTT

EFEREIGF

270-300

forward primer for PG2

Hox2S(E1)R

YTTYTTCTCYTTCATCCANGG

PWMKEKK

--

reverse primer for PG2

PG3

Hox3S(E1)F

ATGCARAAARCRRCNTAYTAYGA

MQKATYYD

400-480

forward primer for PG3

HoxC3(E1)F

ATGCAAAARGSTCYYTAYTAYGA

MQKGPYYE

400-480

forward primer for HoxC3

HoxA3(E1)F

GCGACCTACTAYGAYAGYTCNGC

ATYYDSSA

390-470

forward primer for HoxA3

HoxD3(E1)F

ATGCAGAAARCNGCYTAYTAYGA

MQKTAYYD

400-480

forward primer for HoxD3

Hox3S(E1)R

TCYTTCATCCANGGRAADATNTG

QIFPWMKE

--

reverse primer for PG3

PG6

HoxB6(5'E1)F

AWACTRCTAATAGCTAAASCRCT

5' UTR

480-510

reverse primer for HoxB6

Hox6S(E1)R

GARTTCATCCKYTGCATCCANGG

PWMQRMNS

--

reverse primer for PG6

PG7

HoxB7(5'E1)F

CTCGTAAAACCGACACTAAAACG

5' UTR

440-460

forward primer for HoxB7

Hox7S(E1)R

CATCCARGGGTADATNCGRAA

FRIYPWM

--

reverse primer for PG7


* PL: Product length.

Liang et al. BMC Evolutionary Biology 2011 11:25   doi:10.1186/1471-2148-11-25

Open Data