Table 1

Alleles of MML0050 locus in the Rv0050 gene from M. tuberculosis

Alleles

Sequences

Mutation patterns

Strains


Insertion

Deletion

Substitution


Rv0050*01

------------------CCGCCGCCGCCGCCGCCGCCG

H37Rv

Rv0050*02

------------------CCGCCGCCGCCGCCGCCGTCG

C→T

H37Ra, CDC1551, KZN1435

Rv0050*03

------------------------CCGCCGCCGCCGCCGTCG

1 motif

C→T

clone Y219

Rv0050*04

------------CCGCCGCCGCCGCCGCCGCCGTCG

1 motif

C→T

F11

Rv0050*05

------CCGCCGCCGCCGCCGCCGCCGCCGTCG

2 motifs

C→T

Rv0050*06

------CCGCCGCCGCCTCCGCCGCCGCCGTCG

2 motifs

G→T; C→T

M. Bovis

Rv0050*07

CCGCCGCCGCCGCCTCCGCCGCCGCCGTCG

3 motifs

G→T; C→T

M. Bovis BCG


Qin et al. BMC Evolutionary Biology 2011 11:247   doi:10.1186/1471-2148-11-247

Open Data