Table 3

Primers designed for RT-PCR for amplification of each group of OR genes

Target gene

Group

Primer set 5'-3'


ORA

δ1

F:GGCTATATGTCAACCTCTG

R:TATACCATAGATTAAAGGATT

ORC

δ1

F:TGTACGTTCTGATTGCAGC

R:TCAGATGTGGTAAACAGGT

ORD

δ1

F:GTACGGCTCTGCGGGCTTCT

R:GGAGGAATCACAACAAACTC

ORE

β

F:ATGTATTTTGTTCACTTTTTAGG

R:AGGCATGTAATACAGACACGTGA

ORF

δ2

F:GATCGTTATGTTGCCATCTG

R:GAGAAATATCAGCATGCCCA

ORG

δ2

F:CCTCCCTCTGAACGCCTCAT

R:CTGCAGGTCTTCAAGGCTTT

ORI

η

F:TGTCTTTGGAGAGGTATGTA

R:GCACTGAGACATCTGGGAAG

ORJ

η

F:ACACGCCTCTGAACCTGGCC

R:ATGATGGTGTTTCTGGCCTT

ORK

η

F:GAGCGGTACGTGGCCATTTG

R:AGACCGTAGATGAGAGGACT

β-actin

F:ATGGAAGATGAAATCGCCGC

R:TGCCAGATCTTCTCCATGTCG


Nine pairs of primers that could amplify OR genes are shown. The primers were designed according to the conserved domain of fugu, pufferfish and zebrafish OR genes. The primers were named according to the subgroup that they amplify.

Zhou et al. BMC Evolutionary Biology 2011 11:237   doi:10.1186/1471-2148-11-237

Open Data