Table 2

Genetic markers, primer sequences, and primer-specific annealing temperatures (Ta) and MgCl2 concentrations

Marker

Primer names

Primer sequences (5'-3')

Ta

(°C)

MgCl2 (mM)

References


COI

LCO1490

HCO2198

TAAACTTCAGGGTGACCAAAAAATCA

GGTCAACAAATCATAAAGATATTGG

50

6

[91]

[91]

ANT

StolidoANT-F

ANTr1

CAGGGTATCATTGTRTACMGAG

CCAGACTGCATCATCATKCGRCGDC

60

3

This study

[44]

ATPSα

ATPSαf1

ATPSαr1

GAGCCMATGCAGACTGGTATTAAGGCYGT

CTGTGGTAGTAGTTGGTCTTCKCNAAGTT

55

3

[44]

[44]

18S

5'F

557F

1262R

3'R

TYCCTGGTTGATYYTGCCAG

GCCAGCAGCCGCGGT

GGTGGTGCATGGCCGTY

TGATCCATCTGCAGGTYCACCT

54

3

[92]

[93]

[93]

[92]


Teske et al. BMC Evolutionary Biology 2011 11:176   doi:10.1186/1471-2148-11-176

Open Data