Table 2

The primer sequences used for the 12 EPIC markers.

Locus

Forward primer sequence

Reverse primer sequence


59107E2

GGAGATGGGYGTGGACTGGTCYCT

ATTGTAGATCTCVTCCACCACCTGRAT

55378E1

ATGARGAAAATGAGGCCAACTTGCT

GCCACCTGKGTATTGATTATAGCTGAG

55305E1

CCTAGTGGACTGTARTAACGCCCCYCT

AAGCCATCCAGTTTGCATAAACACTATC

40245E5

CTGAGGAGGAYGGCTGGGARTTYGT

ACCATCAGCTTCACCACCTGCTC

36298E1

GATCCTGAGGGAYTCCCAYGGTGT

GGGCCAGGACTCTCYTGGTCTTGTAGT

25073E1

GTACTCTCKGTACATGTTGTGRGTKCC

GAAGGTGAARAACTTTGGBATCTGG

19231E4

CGGARGACTACGGACGTGATTTGAC

CTCCYTCCAGTGSTCCACAAACT

14867E1

CCACAARTACAAGGCCAAGAGRAACTG

GTTCTCCTTSTCCTGSACGGTCTT

8680E3

GGAGGAGARTTYAAGAAGTAYCTGGACAT

CSCCCTTCAGGCCCTGGATGAT

8680E2

GATATGGTGGAYTACCTGAACGASCTG

TCCTCAGCKATGTGGTGRATGAA

4174E20

CTYTCGCTGGCTTTGTCTCAAATCA

CTTTTACCATCKCCACTRAAATCCAC

1777E4

AGGAGYTGGTGAACCAGAGCAAAGC

AGATCRGCCTGAATSAGCCAGTT


Li et al. BMC Evolutionary Biology 2010 10:90   doi:10.1186/1471-2148-10-90

Open Data