Email updates

Keep up to date with the latest news and content from BMC Evolutionary Biology and BioMed Central.

Open Access Research article

The origin and evolution of ARGFX homeobox loci in mammalian radiation

Guang Li12 and Peter WH Holland1*

Author Affiliations

1 Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK

2 Key Laboratory of the Ministry of Education for Cell Biology and Tumor Cell Engineering, School of Life Sciences, Xiamen University, Xiamen, 361005, China

For all author emails, please log on.

BMC Evolutionary Biology 2010, 10:182 doi:10.1186/1471-2148-10-182


The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2148/10/182


Received:25 January 2010
Accepted:17 June 2010
Published:17 June 2010

© 2010 Li and Holland; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

Many homeobox genes show remarkable conservation between divergent animal phyla. In contrast, the ARGFX (Arginine-fifty homeobox) homeobox locus was identified in the human genome but is not present in mouse or invertebrates. Here we ask when and how this locus originated and examine its pattern of molecular evolution.

Results

Phylogenetic and phylogenomic analyses suggest that ARGFX originated by gene duplication from Otx1, Otx2 or Crx during early mammalian evolution, most likely on the stem lineage of the eutherians. ARGFX diverged extensively from its progenitor homeobox gene and its exons have been functional and subject to purifying selection through much of placental mammal radiation. Surprisingly, the coding region is disrupted in most mammalian genomes analysed, with human being the only mammal identified in which the full open reading frame is retained. Indeed, we describe a transcript from human testis that has the potential to encode the full deduced protein.

Conclusions

The unusual pattern of evolution suggests that the ARGFX gene may encode a functional RNA or alternatively it may have 'flickered' between functional and non-functional states in the evolutionary history of mammals, particularly in the period when many mammalian lineages diverged within a relatively short time span.

Background

The homeobox genes comprise a large and diverse gene superclass characterized by presence of a DNA motif encoding the homeodomain. Most homeodomain proteins function as transcription factors involved in switching other genes on or off during embryonic development, cell fate specification and cell differentiation. The pivotal importance of homeobox genes to animal development is demonstrated by the fact that mutation or experimental misexpression can cause dramatic developmental abnormalities or cancers [1-3]. The best known homeobox genes include Hox, ParaHox, NK, Otx, Pax and Dlx genes which have been extensively studied in many animal model systems including mice, zebrafish, nematodes and Drosophila. Indeed, it was comparison of homeobox genes between species that led to one of the most striking findings of twentieth century biology: the remarkable conservation of homeobox and other developmental patterning genes between very divergent animal phyla [4,5].

Not all homeobox genes are ancient, however, and the extent of their evolutionary conservation varies considerably. For example, a detailed search for all homeobox loci in the human genome sequence revealed six novel genes, DPRX, ARGFX, TPRX1, DUXA, DUXB and LEUTX, each of which has no orthologue in the mouse genome, nor in invertebrate genomes [6,7]. It was hypothesized that these homeobox loci originated relatively recently in evolution and had undergone rapid sequence evolution. Booth and Holland [6] suggested that DPRX, TPRX1 and DUXA may have originated by tandem duplication and extensive sequence divergence from the CRX homeobox gene (a member of the ancient and conserved Otx gene family), because TPRX1 is adjacent to CRX and the other two homeobox genes are just 5.8 Mb and 9.2 Mb distant in chromosomal region 19q13. The evolution of DUXA and DUXB was studied by Clapp et al [8] who showed that these genes originated before mammalian radiation but have been lost from mouse. In contrast, the origin and subsequent evolution of the ARGFX locus remains very unclear. Human ARGFX maps to 3q13 so is not in the same chromosomal region as CRX, or indeed any other Paired (PRD) class homeobox gene. The sequence of its homeodomain assigns ARGFX as a divergent member of the PRD class [6], but gives no clear solution to its mode of origin. In addition, it is not yet certain whether ARGFX is a true functional gene or a nonfunctional pseudogene. The existence of two human retrotransposed pseudogenes derived from ARGFX, three ESTs from human testis tumor and a weakly positive RT-PCR amplification from human testis and embryonic stem cells indicates a low level of ARGFX transcription in humans [6]. Here we undertake a comparative study of ARGFX sequences in vertebrate genomes to investigate the origin, the patterns of mutation and gene loss, and the extent of evolutionary conservation of this locus.

Results and Discussion

Human ARGFX gene and transcript

Although human AGRFX has been shown to be weakly expressed in human testis and ES cells [6], the full transcript has not been previously cloned or experimentally verified. Indeed, only one of the four predicted intron positions in the human ARGFX was originally verified from cDNA (intron 4); the other three intron positions were predicted by sequence comparison to two retroposed pseudogenes deduced to be derived from ARGFX [6]. We therefore designed a range of ARGFX-specific forward and reverse primers and conducted RT-PCR and RACE PCR on human testis RNA. 5' RACE PCR was unsuccessful, but 3' RACE generated a product that was polyadenylated approximately 30 nucleotides downstream from the predicted stop codon. This termination may be artificial or an alternative polyadenylation site; we note that it is preceded by a canonical AATAAA polyadenylational signal. RT-PCR using forward and reverse gene-specific primers successfully amplified from exon 1 to exon 5, verifying that all four predicted introns are faithfully spliced out in a processed human RNA product (Figure 1). The assembled sequence has the potential to code for a protein of 315 amino acids including a 60 amino acid homeodomain. We conclude that the original annotation was correct, at least across the putative coding region of the ARGFX locus. This annotation includes the unusual exon 3 noted by Booth and Holland [6] which is comprised from the 'right arm' of an Alu element. Interestingly, the transcriptional direction of the ARGFX locus is opposite to that expected for parental Alu elements; this is consistent with the finding of Gal-Mark et al. [9] that most exonizations of Alu elements occur in the right arms of antisense Alu elements.

thumbnailFigure 1. Gene structure of human ARGFX. PCR primer positions and amplicons are shown relative to predicted human ARGFX gene structure [6]. Boxes indicate exons, drawn to scale; lines indicate introns, not drawn to scale. Numbers above boxes and beneath lines indicate the lengths of each exon and intron. The 5' and 3' untranslated regions are shown in white and the protein coding regions are shown in black, except for the homeodomain which is red.

Since the ARGFX mRNA is present at very low levels, we suspected that detection of a protein product would be difficult. We carried out western blots on human testis total protein using a commercial polyclonal antibody and detected a single band of 50 kDa (data not show); this is much larger than the expected 36 kDa. The size discrepancy suggests the band is artefactual and may reflect the fact that the antibody was raised to the whole protein including the Alu region. We note that exonized coding Alu elements are also found in several proteins; examples include DSERG1 (GeneID 751816), ZMAT1 (GeneID 84460) and POLR3B (GeneID 55703). In addition, we searched the PeptideAtlas http://www.peptideatlas.org/ webcite and PRIDE database http://www.ebi.ac.uk/pride/ webcite and found four matches in the latter. However, these spectra did not pass the filtering criteria used, and thus do not provide conclusive evidence for translation of human ARGFX gene.

The evolutionary origin of ARGFX sequences

The ARGFX locus was first identified in the human genome, but no homologous sequence was found in mouse, even though the syntenic region is readily identified [6]. To trace the origin of ARGFX, we searched a wide phylogenetic range of vertebrate genome sequences using tblastn. We detected ARGFX-related sequences in many, but not all, placental mammals (Figure 2; Additional file 1). ARGFX-related sequences with or without predicted introns were identified in chimpanzee, gorilla, orangutan, rhesus macaque, marmoset, tarsier, mouse lemur, bushbaby, tree shrew, squirrel, guinea pig, rabbit, pika, horse, cat, dolphin, alpaca, cow, megabat, shrew, elephant, tenrec and armadillo. No closely similar matches were detected in mouse, rat, dog, non-placental mammals (opossum and platypus) or non-mammalian vertebrates (or indeed invertebrates),

thumbnailFigure 2. ARGFX gene in vertebrates. The phylogenetic tree of mammals is based on [29-32]. Column 1: ARGFX is inferred to be a probable gene (√), possible pseudogene with disrupted coding region (ψ), secondarily completely lost (×) or not included in current genome data (?). Column 2: Minimal number of retrotransposed ARGFX pseudogenes based on current genome data. Column 3: Synteny with the human ARGFX genomic region is conserved (√) or not (×), or not sequenced (?).

Additional file 1. ARGFX sequences used in this study (MS Word format).

Format: DOC Size: 207KB Download file

This file can be viewed with: Microsoft Word ViewerOpen Data

To further refine these results, we used a more sensitive method that exploited the fact that ARGFX has readily recognized flanking genes within an easily identified syntenic region. Starting with the human ARGFX genomic region, we were able to identify the corresponding genomic region in virtually all placental mammals, plus opossum (a non-placental mammal) and a frog (Xenopus tropicalis). We then used mVISTA to search these regions at low stringency for any sequences related to human ARGFX. In neither opossum nor frog was there detectible ARGFX-related sequence in the corresponding region. The locus was also missing from the syntenic region of mouse, rat and dog.

By combining the sequence similarity searching and the synteny analyses with a probable phylogenetic tree of the vertebrates, we can deduce the likely date of evolutionary origin of ARGFX homeobox loci (Figure 2). The absence of the locus in mouse, rat and dog clearly reflects secondary loss, since these species are nested within the tree of placental mammals. The minimal inclusive clade containing taxa possessing ARGFX sequences encompasses Xenarthra, Afrotheria, Supraprimates and Laurasiatheria. In contrast, there is no evidence that ARGFX sequences existed before the origin of placental mammals. We propose, therefore, that ARGFX originated after the divergence of Eutheria from Metatheria.

The human ARGFX gene has similar exon-intron organisation to the human OTX1, OTX2 and CRX genes as depicted in Figure 3. The latter three genes are part of a gene family, Otx, which is well conserved across the Metazoa. Although human ARGFX gene has an additional coding exon compared to the three Otx genes, this derives from an Alu element (see above) and we find this is not present in the predicted tree shrew and megabat ARGFX genes (Figure 3). This is consistent with the observation that Alu elements are primate-specific repetitive sequences [10]. In addition to similar gene organisation, we also detected patches of shared sequence similarity in exons and surrounding genomic regions between ARGFX and the three canonical Otx genes (Figure 4). A phylogenetic analysis using complete predicted protein sequences reflects this, as it groups ARGFX with OTX1, OTX2 and CRX (ML 97% bootstrap; Bayesian 1.0 support value; Figure 5). One possibility is that ARGFX originated by gene duplication from one of the three canonical vertebrate Otx genes, on the stem lineage of the eutherian mammals. If this occurred, it must have been followed by extensive sequence divergence because the human ARGFX homeodomain shares only 55% to 56.7% amino acid sequence identity with human Otx family genes over 60 amino acids (genes within a homeobox gene family generally share 70 to 100% homeodomain amino acid identity [7,11]).

thumbnailFigure 3. Comparison of ARGFX, OTX1, OTX2 and CRX gene structures. Human TPRX1, DPRX, HESX1 and GSC gene structures were used as references. Exons are represented by boxes and introns by lines, with the length in nucleotides written above. The 5' and 3' untranslated regions are shown in white and the protein coding regions in black except for homeodomains which are shown in red. Human gene structures follow the NCBI gene annotation; tree shrew and megabat ARGFX intron positions were deduced by reference to retroposed pseudogenes.

thumbnailFigure 4. Greater conservation of DNA sequences between human ARGFX, OTX1 and OTX2 genomic regions than with DPRX and TPRX1. Human GSC and HESX1 were also used as references, but no similarity was found. Genomic sequences from the last base pair of upstream gene to the first base pair of downstream gene for each locus (based on UCSC at http://genome.ucsc.edu/ webcite were used, and compared using Shuffle-LAGAN [28] in mVISTA, which can detect sequence rearrangements. Coloured peaks (purple, coding; pink, intergenic; blue, transcribed non-coding) indicate regions of at least 30 bp and 30% similarity.

thumbnailFigure 5. Phylogenetic relationship between ARGFX and other PRD class homeobox genes. Maximum likelihood phylogenetic tree constructed using complete deduced human ARGFX protein sequence and the most similar human homeodomain proteins. Bootstrap support values over 50% are shown. Essentially the same topology was recovered by Bayesian analysis except at weakly supported nodes, notably the position of VSX1.

If ARGFX did originate as proposed, it is not clear which Otx gene was the progenitor, since ARGFX is on a different chromosome to all three candidates. Interestingly, the canonical Otx genes share more sequence similarity with ARGFX than they do with DPRX and TPRX1 which are located close to CRX chromosomally (Figure 4).

If we accept the proposal that ARGFX is a duplicate either of CRX, OTX1 or OTX2, then the vertebrate Otx gene family comprises four genes (or indeed more, if TPRX1 and DPRX originated by a similar mode). The number four is interesting because it is now clear that two rounds of whole genome duplication (2R) occurred in early vertebrate evolution [12,13]. These events expanded each ancestral chordate gene to a complement of four, before subsequent gene losses. Although we hypothesize that ARGFX originated on the stem lineage of the eutherian mammals, it is also worth testing an alternative hypothesis that ARGFX is actually the 'cryptic' fourth Otx paralogue dating to the much more ancient 2R genome duplications. Such a hypothesis would predict that the three canonical Otx genes, plus ARGFX, map to a fourfold paralogy region in the human genome, homologous to a single chromosomal region in amphioxus. To test this we identified 24 genes neighbouring the amphioxus Otx gene (scaffold 8; B. floridae genome assembly v1.0, http://genome.jgi-psf.org/Brafl1/Brafl1.home.html webcite) and found their human homologues, verifying each by constructing neighbor-joining phylogenetic trees. Examining their chromosomal locations revealed that most human orthologues are distributed on four human chromosomes (2, 10, 11, 14), three of which accommodate OTX1, OTX2 and CRX, plus a smaller number on chromosome 1 (possibly reflecting breakage of a fourfold paralogy region; Figure 6). In contrast, only one human orthologue (BOC) was found on chromosome 3, the location of ARGFX. This result implies that while OTX1, OTX2 and CRX were generated by two rounds of genome duplication in early vertebrate evolution, ARGFX was not.

thumbnailFigure 6. Synteny and paralogy around the Otx gene family. Map positions of amphioxus Otx and its neighbouring genes are compared to their human orthologues, which map primarily to chromosomes 1, 2, 14, 11 and 19, not chromosome 3. Amphioxus genes are shown in their physical order, and are numbered as in amphioxus (B. floridae) genome assembly v. 1.0. GeneID 20 is amphioxus Otx. GeneID 22 and 23 are most likely two parts of a gene and are treated as one locus. Human orthologues are not necessarily in order. Amphioxus genes 2 and 19 (black boxes) do not have clear human homologues; phylogenetic relationships are not well resolved for amphioxus genes 8, 17 and 24 (grey boxes). Human orthologues of amphioxus gene 13 do not map to on the five main chromosomal regions.

In summary, we propose that ARGFX originated after the divergence of Eutheria from Metatheria. This view is strongly supported by the phylogenetic distribution of ARGFX sequences in mammals and by analysis of the ARGFX syntenic region in placental and marsupial mammals and an amphibian. An alternative hypothesis, that the origin of ARGFX dates to genome duplication events in early vertebrate evolution, gains no support from paralogy analysis. It is likely, therefore, that the eutherian mammal ARGFX locus originated by gene duplication from CRX, OTX1 or OTX2, followed by extensive sequence divergence from these conserved Otx genes.

Mutation in placental mammals

Although ARGFX-related sequences were identified in most placental mammals examined, we were surprised to find that each one carried critical sequence mutations when compared to the human ARGFX open reading frame. In no case did a non-human ARGFX locus contain an intact open reading frame of equivalent length to the human sequence (Figure 1), and hence we conclude that none can code for a functional protein. Furthermore, each lineage of mammals has different disabling mutations (Additional file 2). For example, within the primates, chimpanzee and gorilla have the start codon ATG mutated to ACG, in orangutan the stop codon TGA is mutated to TCA causing termination four codons further downstream, macaque has a four base-pair insertion causing a frameshift, and marmoset and mouse lemur each have different stop codon mutations resulting in a shorter protein. In other mammals, tree shrew has two frameshift mutations and one premature stop codon, guinea pig has four separate frameshift deletions in the C-terminus, cow has a ten base pair deletion at the N-terminus causing a frameshift and a pair of two-nucleotide deletions at the C-terminus, horse has a one nucleotide insertion, two premature stop codons and deletions within the homeobox, while megabat has three frameshift mutations and a premature stop codon. As already mentioned, mouse, rat and dog have lost the locus secondarily.

Additional file 2. Alignment of eleven ARGFX coding sequences showing mutations leading to frameshifts (in grey shade) or stop codons (in red shade). The homeobox is underlined.

Format: PDF Size: 57KB Download file

This file can be viewed with: Adobe Acrobat ReaderOpen Data

These results are particularly surprising when considered in relation to the phylogenetic tree of mammals (Figure 2), because the range of species in which mutation of the ARGFX locus is found do not form a monophyletic group to the exclusion of humans. There are several possible explanations for this unusual pattern. First, ARGFX may be a non-functional pseudogene in all mammals, and the intact open reading frame in humans is simply a stochastic variant of a sequence diverging in a neutral manner. This would imply a single loss of function event soon after the origin of ARGFX in the eutherians. Second, the ARGFX locus may have been functional for the entire evolutionary history of humans, and is still functional, but has become a pseudogene (or has been lost) in many independent mammalian lineages. This would imply at least 10 independent loss of function events in mammalian evolution, if the phylogeny used in Figure 2 is correct. Third, the gene may have 'flickered' between functional and non-functional states in the evolutionary history of mammals. This might imply a smaller number of independent loss of function events, yet selective maintenance of function for at least part of human evolutionary history. Fourth, the locus may be functional as an RNA but not as a protein in most mammals.

Signatures of selection in ARGFX evolution

The unusual evolutionary pattern prompted us to reconsider whether human ARGFX locus encodes a functional gene, or indeed whether ARGFX has ever been functional. Detection of a transcription product from the locus, or even a putative translation product, is not sufficient evidence; many pseudogenes are transcribed [14,15]. Finding a human phenotype associated with mutation of ARGFX would be informative, but so far no such human condition is known. We therefore addressed this question from an evolutionary perspective. Two approaches were employed.

First, we tested whether there were signatures of positive or negative selection pressure in the coding region by calculating the ratio of numbers of nonsynonymous to numbers of synonymous substitutions per site, dN/dS (ω). We used human, chimpanzee and orangutan ARGFX sequences to facilitate accurate alignment. Among the three pairwise ω ratios, one is greater than 1.0 and the other two close to 1.0 (table 1). We then divided the coding region into three parts, N-terminal, homeodomain and C-terminal, and calculated ω values separately. All three pairwise ω values for the N-terminal part were more than 1.0, but ω values for the other two parts are far below 1.0, suggesting that the N-terminal part has encountered positive selection while the homeodomain and C-terminus sequences have been strongly constrained by negative selection. Plotting potential positively selected sites onto the open reading frame revealed nearly half of them (6/14, posterior probability > 80%) are in the region coded by the Alu element (data not shown). To control for the possibility that the Alu element is affected by evolutionary processes beyond ARGFX functional constraints, we removed the Alu element and re-calculated the nonsynonymous to synonymous ratio. As expected, the ω values for the full sequence dropped significantly and were now below 1.0 (p < 0.05, Z-test). Taken together, these results argue that human ARGFX is a functional gene with some sites under positive selection pressure, but the majority of the sequence is under negative or purifying selection.

Table 1. dN and dS values in different analyses

The second approach taken was to compare more widely divergent mammals and examine the extent of conservation in exonic and intronic sequence. If the gene has been functional during much of mammalian evolution, we predict that exonic sequence would be more highly conserved than intronic sequence. Multiple alignments revealed that ARGFX exons (and sequences immediately flanking exons) show much higher conservation than introns between divergent lineages (Figure 7). Furthermore, the level of conservation is not uniform between regions of the deduced protein, but is much higher within the homeodomain than the N-terminal and C-terminal regions (mean Poisson corrected distance: 0.280 vs 0.851 and 0.461). Among 45 possible pairwise comparisons between 10 species, all distances for homeodomains are much less than corresponding values for the N-terminal region and only 8 of them are slightly greater than corresponding values for the C-terminal region (Additional file 3). These results indicate that the coding sequence of the ARGFX homeobox locus, and in particular the homeobox, has been under purifying selection for much of mammalian evolution.

thumbnailFigure 7. Conservation of DNA sequence conservation between mammalian ARGFX genomic sequences. Only species with a high genome assembly in this region were used. Sequences were aligned by the LAGAN program [17] in mVISTA. Length of the genomic region for each species is on the right. Macaque is missing a region between exon 2 and exon 4 accounting for higher similarity between human and marmoset than human and macaque in this region. The higher sequence similarity in and around exons is clearly visible, indicative of selective constraints since divergence of the species shown. Coloured peaks (purple, coding; pink, intergenic; light blue, UTR) indicate regions of at least 50 bp and 50% similarity.

a. mVISTA plot using repeat-masked genomic sequences; b. mVISTA plot using sequence with no masking of repeats.

Additional file 3. Pairwise poisson-distances between ten deduced ARGFX protein sequences.

Format: DOC Size: 91KB Download file

This file can be viewed with: Microsoft Word ViewerOpen Data

Conclusion

In this study, we have performed a deep comparative phylogenetic and phylogenomic analysis on the recently described homeobox locus ARGFX. We present evidence that this gene originated by gene duplication from Otx1, Otx2 or Crx during early mammalian evolution. The most likely origin was on the stem lineage of the eutherian mammals, after their divergence from marsupials and monotremes, and before the radiation of living placental mammals. The gene diverged extensively in sequence from its progenitor homeobox gene and was then subject to purifying selection. This purifying selection was maintained through much of placental mammal radiation, even though the coding sequence of the locus is disrupted in most mammalian genomes analysed. Strangely, human is the only mammal studied to date in which the full open reading frame is retained, and we suggest that the ARGFX locus is still functional in human. Indeed, we detected a transcript in human testis that has the potential to encode the full deduced protein. The unusual pattern of conservation suggests either that there have been very many independent losses of function for this gene in mammalian radiation, or, that the gene encodes a functional RNA molecule. An alternative hypothesis is that the gene has 'flickered' between functional and non-functional states in the evolutionary history of mammals, particularly during the late Cretaceous period when many mammalian lineages diverged in a relatively short timespan.

Methods

cDNA cloning of human ARGFX

Human testis total RNA was obtained commercially from AMS Biotechnology Ltd. (Cat. No. R1234260-50), and used to synthesize cDNA using a SMART RACE kit (Clontech Laboratories Inc.). Based on open reading frame predictions made from genomic DNA, gene-specific primers were used to amplify and clone ARGFX cDNA covering the complete predicted open reading. Forward primers used were: H.sa-ARGFX-F1 (CACGTAGGACTGAAAATGGTTACTC in exon 1) and HsARGFX-51F (CGGAGAAGGCATAAAGAACG in exon 4). Reverse primer was HsARGFX-51Rm (AGGGTCTAAGGGCTGAGATGG in exon 5). Primer positions are shown in Figure 1. To examine whether the transcribed mRNA is translated, western blots were performed using human ARGFX polyclonal antibody (Abcam Inc., Cat. no. ab67562) and human testis total protein (AMS Biotechnology, Cat. no. P1234260).

Identification of ARGFX sequences in other vertebrates

Initially, we focused attention on nineteen vertebrate genome sequences of high quality in Ensembl (release 56) accessible at http://www.ensembl.org/index.html webcite, comprising ten mammals (chimpanzee, orangutan, rhesus macaque, mouse, rat, dog, cow, horse, opossum, platypus), two birds (chicken, zebra finch), one reptile (anole lizard), one amphibian (Xenopus tropicalis) and five teleost fish (Tetraodon, Takifugu, medaka, stickleback, zebrafish). Genomes were searched using tblastn [16] with human ARGFX deduced protein sequence as the query and an E-value cutoff of 1e-5. Many partial genome sequences were also searched. In cases where no match was detected, this can be due either to incomplete sequencing, complete absence or to partial degeneration. To distinguish between these possibilities, we identified the region of each genome assembly syntenic to the human ARGFX location and searched this for short degenerated sequences related to ARGFX using the LAGAN program [17] implemented in mVISTA http://genome.lbl.gov/vista/mvista/submit.shtml webcite with a match criterion of 50% identity over 50bp. All sequences used in analysis are included in Additional file 1.

Phylogenetic analysis

Nucleotide sequences and deduced protein sequences were aligned using CLUSTAL_X [18]. NJ (Neighbor-Joining) trees [19] were calculated using MEGA4 [20] using the Kimura 2-parameter distance estimation for nucleotide sequences and Poisson distance estimation for protein sequences [21]. ML (maximum likelihood) trees were constructed using PHYML [22] using the JTT model, estimated to be the most appropriate model by ProtTest [23]. The reliability of interior nodes in ML and NJ tree was assessed by bootstrapping with 100 replications [24]. Bayesian trees were constructed using MrBayes 3.1 with 1.2 million cycles and sampling 1/10 of trees after a 30,000 cycle burn-in [25]. Deduced protein sequences used for ARGFX trees were human ARGFX (without the region encoded by the Alu element), NP_001012677, and the thirteen most similar human proteins according to blastp: human CRX, NP_000545; human OTX2, NP_068374; human OTX1, NP_055377; human UNCX, NP_001073930; human ALX1, NP_008913; human PHOX2B, NP_003915; human PAX6, NP_001595; human DRGX, NP_001073989; human DMBX1, NP_671725; human ALX4, NP_068745; human PHOX2A, NP_005160; human VSX1, NP_055403; human ALX3, NP_006483. Numbers of synonymous (dS) and nonsynonymous (dN) per site were calculated using the modified Nei-Gojobori Jukes-Cantor method [26] implemented in MEGA4. Potential positive selected sites were determined using codeml program in PAML 4 package [27]. Alignments of genome sequences were undertaken using LAGAN [17] or Shuffle-LAGAN programs [28] implemented through mVISTA http://genome.lbl.gov/vista/mvista/submit.shtml webcite.

Abbreviations

ARGFX: (Argnine-fifty homeobox); dS: synonymous; dN: nonsynonymous; RACE: Rapid Amplification of cDNA Ends.

Authors' contributions

PWHH designed the study. GL carried out database searching and performed experiments and data analyses. PWHH and GL drafted the manuscript. Both authors edited and approved the final manuscript.

Acknowledgements

The authors thank Yaseen Ladak and Tommy Duncan for help with western blots, and Ying-fu Zhong for help with Bayesian analysis.

References

  1. Cillo C: HOX genes in human cancers.

    Invasion & Metastasis 1994, 14:38-49. PubMed Abstract OpenURL

  2. Nunes FD, de Almeida FC, Tucci R, de Sousa SC: Homeobox genes: a molecular link between development and cancer.

    Pesquisa Odontologica Brasileira = Brazilian Oral Research 2003, 17:94-98. PubMed Abstract | Publisher Full Text OpenURL

  3. Del Bene F, Wittbrodt J: Cell cycle control by homeobox genes in development and disease.

    Seminars in Cell & Developmental Biology 2005, 16:449-460. PubMed Abstract | Publisher Full Text OpenURL

  4. Kappen C, Ruddle FH: Evolution of a regulatory gene family: HOM/HOX genes.

    Current Opinion in Genetics & Development 1993, 3:931-938. PubMed Abstract | Publisher Full Text OpenURL

  5. Manak JR, Scott MP: A class act: conservation of homeodomain protein functions.

    Development (Cambridge, England) 1994, :61-77. OpenURL

  6. Booth HAF, Holland PWH: Annotation, nomenclature and evolution of four novel homeobox genes expressed in the human germ line.

    Gene 2007, 387:7-14. PubMed Abstract | Publisher Full Text OpenURL

  7. Holland PWH, Booth HAF, Bruford EA: Classification and nomenclature of all human homeobox genes.

    BMC Biology 2007, 5:47. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL

  8. Clapp J, Mitchell LM, Bolland DJ, Fantes J, Corcoran AE, Scotting PJ, Armour JA, Hewitt JE: Evolutionary conservation of a coding function for D4Z4, the tandem DNA repeat mutated in facioscapulohumeral muscular dystrophy.

    American Journal of Human Genetics 2007, 81:264-279. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  9. Gal-Mark N, Schwartz S, Ast G: Alternative splicing of Alu exons--two arms are better than one.

    Nucleic Acids Research 2008, 36:2012-2023. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  10. Kriegs JO, Churakov G, Jurka J, Brosius J, Schmitz J: Evolutionary history of 7SL RNA-derived SINEs in Supraprimates.

    Trends Genet 2007, 23:158-161. PubMed Abstract | Publisher Full Text OpenURL

  11. Takatori N, Butts T, Candiani S, Pestarino M, Ferrier DE, Saiga H, Holland PWH: Comprehensive survey and classification of homeobox genes in the genome of amphioxus, Branchiostoma floridae.

    Development Genes and Evolution 2008, 218:579-590. PubMed Abstract | Publisher Full Text OpenURL

  12. Garcia-Fernandez J, Holland PW: Archetypal organization of the amphioxus Hox gene cluster.

    Nature 1994, 370:563-566. PubMed Abstract | Publisher Full Text OpenURL

  13. Putnam NH, Butts T, Ferrier DE, Furlong RF, Hellsten U, Kawashima T, Robinson-Rechavi M, Shoguchi E, Terry A, Yu JK, et al.: The amphioxus genome and the evolution of the chordate karyotype.

    Nature 2008, 453:1064-1071. PubMed Abstract | Publisher Full Text OpenURL

  14. Zheng D, Zhang Z, Harrison PM, Karro J, Carriero N, Gerstein M: Integrated pseudogene annotation for human chromosome 22: evidence for transcription.

    Journal of Molecular Biology 2005, 349:27-45. PubMed Abstract | Publisher Full Text OpenURL

  15. Frith MC, Wilming LG, Forrest A, Kawaji H, Tan SL, Wahlestedt C, Bajic VB, Kai C, Kawai J, Carninci P, et al.: Pseudo-messenger RNA: phantoms of the transcriptome.

    PLoS Genetics 2006, 2:e23. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  16. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.

    Nucleic Acids Research 1997, 25:3389-3402. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  17. Brudno M, Do CB, Cooper GM, Kim MF, Davydov E, Green ED, Sidow A, Batzoglou S: LAGAN and Multi-LAGAN: efficient tools for large-scale multiple alignment of genomic DNA.

    Genome Research 2003, 13:721-731. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  18. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

    Nucleic Acids Research 1997, 25:4876-4882. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  19. Saitou N, Nei M: The neighbor-joining method: a new method for reconstructing phylogenetic trees.

    Molecular Biology and Evolution 1987, 4:406-425. PubMed Abstract | Publisher Full Text OpenURL

  20. Tamura K, Dudley J, Nei M, Kumar S: MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0.

    Molecular Biology and Evolution 2007, 24:1596-1599. PubMed Abstract | Publisher Full Text OpenURL

  21. Nei M, Kumar S: Molecular evolution and phylogenetics. New York: Oxford University Press; 2000. OpenURL

  22. Guindon S, Lethiec F, Duroux P, Gascuel O: PHYML Online--a web server for fast maximum likelihood-based phylogenetic inference.

    Nucleic Acids Research 2005, (33 Web Server):W557-559. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  23. Abascal F, Zardoya R, Posada D: ProtTest: selection of best-fit models of protein evolution.

    Bioinformatics (Oxford, England) 2005, 21:2104-2105. PubMed Abstract | Publisher Full Text OpenURL

  24. Felsenstein J: Confidence limits on phylogenies: an approach using the bootstrap.

    Evolution 1985, 39:783-791. Publisher Full Text OpenURL

  25. Ronquist F, Huelsenbeck JP: MrBayes 3: Bayesian phylogenetic inference under mixed models.

    Bioinformatics (Oxford, England) 2003, 19:1572-1574. PubMed Abstract | Publisher Full Text OpenURL

  26. Zhang J, Rosenberg HF, Nei M: Positive Darwinian selection after gene duplication in primate ribonuclease genes.

    Proceedings of the National Academy of Sciences of the United States of America 1998, 95:3708-3713. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  27. Yang Z: PAML 4: phylogenetic analysis by maximum likelihood.

    Molecular Biology and Evolution 2007, 24:1586-1591. PubMed Abstract | Publisher Full Text OpenURL

  28. Brudno M, Malde S, Poliakov A, Do CB, Couronne O, Dubchak I, Batzoglou S: Glocal alignment: finding rearrangements during alignment.

    Bioinformatics (Oxford, England) 2003, 19(Suppl 1):i54-62. PubMed Abstract | Publisher Full Text OpenURL

  29. Murphy WJ, Eizirik E, Johnson WE, Zhang YP, Ryder OA, O'Brien SJ: Molecular phylogenetics and the origins of placental mammals.

    Nature 2001, 409:614-618. PubMed Abstract | Publisher Full Text OpenURL

  30. Nishihara H, Maruyama S, Okada N: Retroposon analysis and recent geological data suggest near-simultaneous divergence of the three superorders of mammals.

    Proceedings of the National Academy of Sciences of the United States of America 2009, 106:5235-5240. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  31. Prasad AB, Allard MW, Green ED: Confirming the phylogeny of mammals by use of large comparative sequence data sets.

    Molecular Biology and Evolution 2008, 25:1795-1808. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  32. Schneider A, Cannarozzi GM: Support patterns from different outgroups provide a strong phylogenetic signal.

    Molecular Biology and Evolution 2009, 26:1259-1272. PubMed Abstract | Publisher Full Text OpenURL