The pluripotency factor LIN28 marks undifferentiated spermatogonia in mouse1Department of Animal Biology, University of Pennsylvania School of Veterinary Medicine, Philadelphia, PA 19104, USA 2Department of Genetics, University of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA
BMC Developmental Biology 2009, 9:38doi:10.1186/1471-213X-9-38 The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-213X/9/38
©
2009 Zheng et al; licensee BioMed Central Ltd. AbstractBackgroundLife-long production of spermatozoa depends on spermatogonial stem cells. Spermatogonial stem cells exist among the most primitive population of germ cells – undifferentiated spermatogonia. Transplantation experiments have demonstrated the functional heterogeneity of undifferentiated spermatogonia. Although the undifferentiated spermatogonia can be topographically divided into As (single), Apr (paired), and Aal (aligned) spermatogonia, subdivision of this primitive cell population using cytological markers would greatly facilitate characterization of their functions. ResultsIn the present study, we show that LIN28, a pluripotency factor, is specifically expressed in undifferentiated spermatogonia (As, Apr, and Aal) in mouse. Ngn3 also specifically labels undifferentiated spermatogonia. We used Ngn3-GFP knockin mice, in which GFP expression is under the control of all Ngn3 transcription regulatory elements. Remarkably, Ngn3-GFP is only expressed in ~40% of LIN28-positive As (single) cells. The percentage of Ngn3-GFP-positive clusters increases dramatically with the chain length of interconnected spermatogonia. ConclusionOur study demonstrates that LIN28 specifically marks undifferentiated spermatogonia in mice. These data, together with previous studies, suggest that the LIN28-expressing undifferentiated spermatogonia exist as two subpopulations: Ngn3-GFP-negative (high stem cell potential) and Ngn3-GFP-positive (high differentiation commitment). Furthermore, Ngn3-GFP-negative cells are found in chains of Ngn3-GFP-positive spermatogonia, suggesting that cells in the Aal spermatogonia could revert to a more primitive state. BackgroundSpermatogenesis is a productive self-renewing system of adult stem cells that continuously generates spermatozoa through life. At the foundation of this system is the spermatogonial stem cells (SSCs) [1-4]. In mouse testis, isolated A (single) spermatogonia (As) are believed to be the most primitive cells and contain the stem cells. In normal situations, while half of As cells divide and give rise to Apr (paired) spermatogonia that are interconnected by cytoplasmic bridges due to incomplete cytokinesis, the remaining half of As cells undergo self-renewal divisions. The Apr spermatogonia further divide to become chains of 4, 8, 16, or 32 Aal (aligned) spermatogonia. The As, Apr, and Aal spermatogonia can only be identified by their topographical configurations on the basement membrane of the seminiferous tubules and are collectively referred to as "undifferentiated" spermatogonia, although this nomenclature causes confusion because this population contain both progenitor cells that undergo differentiation and stem cells that are truly undifferentiated [5]. The Aal spermatogonia differentiate into A1 spermatogonia, which undergo six cell divisions before entering meiosis via A2, A3, A4, Intermediate, and B spermatogonia. The transition from Aal (undifferentiated) to A1 (differentiating) is a sensitive step during spermatogonial development, as it can be disrupted by several conditions such as cryptorchidism and Vitamin A deficiency [3]. Spermatogonial transplantation along with other studies have demonstrated that SSCs are a subpopulation of undifferentiated spermatogonia, most likely As cells, but not differentiating spermatogonia (A1 to B) [3,6]. Subdivision of the undifferentiated spermatogonia using cytological markers would greatly facilitate characterization of this unique cell population, but so far has not been achieved. We previously identified Lin28 (formerly called Tex17) as a gene differentially expressed in mouse spermatogonia by a cDNA subtraction screen [7]. Lin28 is predominantly expressed in primitive type A spermatogonia [8]. Lin28, encoding an evolutionarily conserved small RNA-binding protein, was first identified as a key regulator of developmental timing in C. elegans [9,10]. In C. elegans, Lin28 is expressed in early larval stage but is rapidly suppressed during embryogenesis and in adult animals by the lin-4 microRNA and the Lin-14 protein [11]. Recently, LIN28 was used together with OCT4, SOX2, and NANOG to reprogram human somatic cells into pluripotent stem cells [12]. In mice, Lin28 is expressed in diverse embryonic tissues, embryonic stem cells, and embryonic carcinoma cells, but not in most adult tissues [10,13]. Collectively, these studies have demonstrated that the expression of Lin28 is associated with pluripotency. In this report, we find that Lin28 is specifically expressed in the undifferentiated spermatogonia (As to Aal) of adult mouse testis. Our analysis of Lin28 and Ngn3 suggests that Lin28-expressing undifferentiated spermatogonia can be cytologically divided into two subpopulations: Ngn3-GFP-negative spermatogonia that contain high stem cell activity/potential and Ngn3-GFP-positive cells that are more committed to differentiation. ResultsLin28 is specifically expressed in germ cells in the testisWe cloned Lin28 (previously known as Tex17) from mouse spermatogonia in a cDNA subtraction screen [7]. Semi-quantitative RT-PCR analysis using enriched germ cell populations showed that the expression of Lin28 in testis is restricted to spermatogonia [8]. Western blot analysis of a panel of adult mouse tissues revealed that the LIN28 protein is abundantly expressed in testis but not in other tissues examined (Fig. 1A). The testis of XXY* male mice completely lack germ cells but contain somatic cells such as Sertoli and Leydig cells [14]. The absence of LIN28 in XXY* testes demonstrated that LIN28 was germ cell-specific (Fig. 1B), in agreement with previous studies [7]. As controls, LIN28 protein was abundant in mouse embryonic stem cells but absent in fibroblast feeder cells (Fig. 1B). We examined the relative protein level of LIN28 in juvenile testes. LIN28 was detectable in testes right after birth, increased its abundance with age, and was most abundant around puberty (day 12 – 18) (Fig. 1C).
LIN28 marks undifferentiated spermatogoniaWe next examined the expression of LIN28 by immunostaining of juvenile testis sections (Additional file 1). LIN28 was expressed in gonocytes from postnatal day 1-old mice and in spermatogonia from day 6- and day 14-old mice. LIN28 was predominantly cytoplasmic with punctate nuclear staining. Immunostaining analysis of adult testis sections revealed that LIN28-expressing cells were sparsely located at the periphery of seminiferous tubules (close to the basement membrane), suggesting that LIN28 is expressed in a subset of spermatogonia but not in meiotic and post-meiotic germ cells (Fig. 2A and Additional file 2). We also found that the number of LIN28-positive spermatogonia per tubule varied among the stages of seminiferous tubules (Fig. 2B). The seminiferous epithelium of mice is divided into twelve stages, each of which is defined by a unique association of differentiating germ cells [15]. For example, undifferentiated Aal spermatogonia become differentiating A1 spermatogonia during stages VII-VIII [3]. Our results showed that the number of LIN28-positive spermatogonia peaked at stage VIII but decreased sharply at stage IX, indicating that LIN28 might be expressed in undifferentiated spermatogonia (Fig. 2B). Additional file 1. Localization of LIN28 in juvenile testes. Frozen sections of mouse postnatal testis (day 1, 6, and 14) were immunostained with anti-LIN28 antibodies (green) and DAPI (blue). Arrows indicate LIN28-positive spermatogonia in seminiferous tubules. Note that LIN28-speramtogonia contain no or little heterochromatin, characteristic of undifferentiated spermatogonia. Scale bar, 50 μm. Format: TIFF Size: 2MB Download file
Additional file 2. Negative controls for immunostaining with anti-LIN28 antibody. (A) Adjacent frozen sections of adult mouse testis were immunostained with (right panel) or without (left panel) anti-LIN28 antibodies (green). In the control section (left), the primary antibody (anti-LIN28) was omitted. Nuclear DNA was stained with DAPI (blue). Composite images from three channels (red, green, blue) were presented to show the autofluorescence of interstitial cells such as Leydig cells indicated by arrowheads. Arrows indicate LIN28-positive spermatogonia in seminiferous tubules. (B) Immunostaining of cultured SSCs with anti-LIN28 and anti-PLZF antibodies (right panel). In the control (left) panel, both primary antibodies were omitted, and only low level of background signal was observed. Scale bar, 50 μm. Format: TIFF Size: 2.2MB Download file To address whether LIN28-expressing cells are indeed undifferentiated spermatogonia, we performed whole-mount immunofluorescent studies on dissected seminiferous tubules from adult testes. In these studies, undifferentiated spermatogonia can be definitively identified as As, Apr, or Aal. The Apr and Aal spermatogonia are connected by intercellular cytoplasmic bridges as a chain of 2n cells. We found that the expression of LIN28 was restricted to As and the chained 2n cells (1, 2, 4, 8, 16, or 32 cells) (Fig. 3A). A chain of 32-interconnected cells was very rare (Fig. 3). Chains with a non-2n number of LIN28-positive cells were also observed at a low frequency (Fig. 3B). GFRA1 (GDNF receptor) is a marker of undifferentiated spermatogonia [16,17]. As expected, LIN28 was expressed in GFRA1-positive spermatogonia (Additional file 3). These whole-mount analyses demonstrated that LIN28 marks the undifferentiated spermatogonia.
Additional file 3. Expression of LIN28 in GFRA1-positive spermatogonia. Seminiferous tubules from adult mice were immunostained with anti-LIN28 and anti-GFRA1 antibodies. As, Apr, and Aal spermatogonia were encircled. Scale bar, 25 μm. Format: TIFF Size: 835KB Download file Expression of LIN28 in cultured spermatogonial stem cells (SSCs)Spermatogonial stem cells (SSCs) are believed to be a subset of As cells [3]. Currently, there are no cytological markers that could distinguish SSCs from "non-stem" As cells. To examine whether LIN28 is expressed in SSCs, we performed double immunostaining of cultured spermatogonia highly enriched for SSCs with anti-LIN28 and anti-PLZF or anti-GFRA1 antibodies. PLZF is required for maintenance of SSCs [18,19]. We found that LIN28 was expressed in cultured SSCs, but the abundance of LIN28 in SSCs was not uniform, suggesting the heterogeneity of in vitro cultured SSCs (Fig. 4A and Additional file 2).
In an attempt to determine the role of Lin28 in the maintenance of SSCs, we treated SSCs with Lin28 siRNAs. The siRNA knockdown decreased the level of Lin28 mRNA by 60% and consequently reduced the abundance of LIN28 protein by nearly 60% (Fig. 4B, C). However, siRNA treatment did not causes a change in the total number of cultured cells (Fig. 4D), suggesting that the remaining LIN28 protein might be sufficient for maintaining SSC or that LIN28 is dispensable for the survival of SSCs. Several recent studies have demonstrated that LIN28 is a negative regulator of let-7 microRNA biogenesis in embryonic stem cells and other stem cells [20-24]. Specifically, LIN28 prevents Dicer from processing let-7 microRNAs by mediating the terminal uridylation of let-7 microRNA precursors [21]. In agreement with these studies, siRNA knockdown of LIN28 in cultured SSCs led to an increased level of mature let-7g miRNA (Fig. 4E). Ngn3-GFP labels a more committed subpopulation of LIN28-positive spermatogoniaNgn3 is specifically expressed in undifferentiated spermatogonia (As to Aal) [25]. To determine if Ngn3 and Lin28 mark the same population of undifferentiated spermatogonia, we made use of Ngn3-GFP mice, in which GFP was inserted into the Ngn3 locus by gene replacement [26]. We performed whole-mount immunostaining of Ngn3-GFP seminiferous tubules with anti-LIN28 and anti-GFP antibodies. This analysis revealed that only a subpopulation of LIN28-positive spermatogonia was GFP-positive (Fig. 5A). Overall, ~40% of LIN28-positive As spermatogonia were GFP-positive, supporting that the population of As cells were not homogeneous. The Apr and Aal spermatogonia were either all GFP-positive or all GFP-negative (Fig. 5A) except a few as described later (Fig. 6). Interestingly, the percentage of Ngn3-GFP-positive spermatogonia increased dramatically as spermatogonia develop from As to Aal (16 cells) (Fig. 5B). While ~40% of As cells were GFP-positive, nearly all Aal (16-cell) spermatogonia were GFP-positive. As the number of chained cells increases, spermatogonia become more and more committed to differentiation. Taken together, our data suggested that Ngn3 delineates a more committed subpopulation of undifferentiated spermatogonia, in contrast, the LIN28-positive but Ngn3-GFP-negative spermatogonia are more primitive.
We observed heterogeneity of Ngn3-GFP expression among Apr and Aal spermatogonia (Fig. 6). In Apr spermatogonia, one cell was GFP-positive and the other was GFP-negative (Fig. 6A). In an 8-cell chain of Aal spermatogonia, seven cells were GFP-positive but one was GFP-negative (Fig. 6B). In a 16-cell chain of Aal spermatogonia, two cells in the middle of the chain were GFP-negative (Fig. 6C). Twelve out of 710 clusters examined (1.7%) were found to contain both GFP-positive and GFP-negative cells in the same chain (one Apr, two 4-cell Aal, six 8-cell Aal, and three 16-cell Aal spermatogonia). The presence of Ngn3-GFP-negative cells in a chain of GFP-positive spermatogonia suggested that the GFP-negative cells might have de-differentiated and thus reverted to a more primitive (stem cell) fate.
DiscussionThe transition from undifferentiated Aal to differentiating A1 spermatogonia is a critical point during spermatogonial development and is tightly regulated [3,5,27]. This transition is specifically perturbed by several conditions, including cryptorchidism, Vitamin A deficiency, and Steel and c-kit mutations [28-31]. In this study, we found that LIN28, a pluripotency factor, is specifically expressed in the undifferentiated (As to Aal) spermatogonia, suggesting that it might play a role in maintaining the undifferentiated state in spermatogonia. Lin28 is expressed in mouse and human embryonic stem cells, embryonic carcinoma cells, neural stem cells, and diverse embryonic tissues [10,13,24,32]. Recently, LIN28, together with OCT4, SOX2, and NANOG, was used to reprogram human fibroblasts to pluripotent stem cells [12]. In mammalian cultured cells, the expression of LIN28 appears to be associated with "stemness" [33]. Very recent studies have discovered a feedback loop, in which LIN28 blocks the maturation of the let-7 microRNAs and Lin28 is downregulated by let-7 [20,24]. Specifically, LIN28 prevents the processing of let-7 precursor microRNAs by Dicer through mediating the terminal uridylation of let-7 precursors [21]. Notably, LIN28 is not essential for reprogramming human fibroblasts into pluripotent stem cells but does increase the reprogramming efficiency [12]. The siRNA knockdown experiments suggested that LIN28 might not be essential for self-renewal of human ES cells [32]. We tested the role of LIN28 in the maintenance of SSCs by siRNA knockdown. The siRNA treatment did not cause a change in the total number of cells in culture, suggesting that LIN28 might be dispensable for maintenance of SSC or that the remaining LIN28 protein after knockdown might be sufficient for its full function. However, consistent with the known function of LIN28 in blockade of let-7 miRNA processing [20,24], we found that siRNA knockdown of LIN28 in cultured SSCs caused an increased level of mature let-7g miRNA. In a recent study of five genes (Bcl6b, Etv5, Bhlhe40, Hoxc4, and Tec) involved in the SSC self renewal, siRNA treatment caused a decrease in the number of SSC stem cells as determined by transplantation without changing the total number of cells in culture [34]. Therefore, the possible involvement of LIN28 in SSC self-renewal remains to be determined by siRNA treatment followed by transplantation in future studies. Ngn3 is also specifically expressed in undifferentiated spermatogonia in mouse [25]. Pulse-chase labeling studies using Ngn3/Cre™ CAG-CAT-Z transgenic (driven by 6.7 kb Ngn3 upstream sequence) mice identified two compartments of spermatogonial stem cells: the actual stem cells and the potential stem cells [35]. In a normal situation, the actual stem cells undergo self-renewal and give rise to transit cells that further divide to become terminally differentiated cells. The transit cells, immediate progeny of actual stem cells, are potential stem cells, in a sense that they can function as stem cells in the case of loss of actual stem cells or when transplanted [35,36]. Nakagawa et al showed that Ngn3-Cre-mediated pulse-labeled spermatogonia contributed to only 0.3% of actual stem cells and to 11.7% of potential stem cells. However, it is difficult to image that such low percentages of contribution to stem cells might be entirely due to the low efficiency of Ngn3/Cre-mediated recombination as previously discussed [35]. We have demonstrated that the population of undifferentiated spermatogonia is cytologically divided into two subpopulations: Ngn3-GFP-negative and Ngn3-GFP-positive. As cells, the most primitive type of undifferentiated spermatogonia, are heterogeneous. More than 40% of LIN28-positive As spermatogonia are Ngn3-GFP-negative. The percentage of Ngn3-GFP-positive clusters increases progressively with the chain length of interconnected undifferentiated spermatogonia (2-, 4-, 8-, 16-cell clusters), suggesting that Ngn3-GFP-expressing spermatogonia are more committed to differentiation (with low stem cell activity), while Ngn3-GFP-negative ones are more primitive (with high stem cell activity). We hypothesize that the low contribution of Ngn3-Cre-mediated pulse-labeled cells to stem cells found in the previous study [35] is more likely attributed to the previously unknown population of Ngn3-negative undifferentiated spermatogonia. Therefore, our current studies together with the pulse-chase labeling experiments done by Nakagawa et al [35] show that the Ngn3-positive cells contain few (0.3%) actual stem cells and some potential stem cells (11.7%). By inference, these studies suggest that the Ngn3-negative undifferentiated spermatogonia might contain >99% of the actual stem cells and nearly 90% of potential stem cells. According to the As model, As (single) spermatogonia and a few Apr (false pairs) can act as stem cells [1-3]. In this model, the As spermatogonium divides either to produce two new stem cells if separate or to become Apr if two daughter cells remain connected by an intercellular bridge. However, it remains unknown whether Apr and Aal spermatogonia in mouse could potentially act as stem cells. In Drosophila testis and ovary, transit-amplifying germ cells can dedifferentiate and revert into functional stem cells [37,38]. Recently, c-kit-positive (differentiating) spermatogonia were shown to be able to revert to functional stem cells when transplanted into testis [39]. Studies of CDH1-expressing spermatogonia showed heterogeneous expression of c-Kit and Tacstd1 among undifferentiated spermatogonia, lending support for de-differentiation in mouse [40]. In the current study of mouse testis, we have observed that, in the same chain of Aal spermatogonia, one or two cells are Ngn3-GFP-negative, while the remaining cells are Ngn3-GFP-positive, suggesting that Ngn3-GFP-negative cells in the Aal spermatogonia might have reverted to a more primitive state. ConclusionIn this study, we have shown that LIN28, a pluripotency factor, is specifically expressed in undifferentiated spermatogonia in mice, suggesting that it might play a role in maintenance of the undifferentiated state of this primitive germ cell population. We have also found that the undifferentiated spermatogonia exist as two subpopulations: Ngn3-GFP-negative (high stem cell potential) and Ngn3-GFP-positive (high differentiation commitment). In addition, our study provides cytological evidence supporting dedifferentiation of spermatogonia in mice. MethodsWestern blot analysisMouse tissues were homogenized using a glass homogenizer in the extraction buffer (62.5 mM Tris-HCl, pH 6.8, 3% SDS, 10% glycerol, 5% β-mercaptoethanol). Protein lysate (20 μg) was separated on 12% SDS-PAGE gels and electro-blotted onto PVDF membranes. Western blotting was performed using the following antibodies: goat anti-LIN28 antibody (1:100, Cat# AF3757, R&D Systems) and anti-β-actin monoclonal antibody (1:2,500, Cat# A5441, Sigma-Aldrich). HRP-conjugated secondary antibodies were used (Sigma-Aldrich). Immunofluorescence microscopyTo prepare frozen sections, testes from C57BL/6J mice of postnatal day 1, 6, 14 or 2-month (adult) were fixed in 4% paraformaldehyde (PFA) at 4°C for 8 hours and were dehydrated in 30% (w/v) sucrose overnight. Testes were embedded with Neg 50 tissue freezing solution (Cat# 6502, Thermo Scientific) and frozen in dry ice/ethanol. Sections (8 μm) were cut using a Reichert-Jung cryo-microtome and then post-fixed in 4% PFA at room temperature for 10 minutes prior to immunostaining. For whole-mount analysis, seminiferous tubules from adult (2-month-old) C57BL/6J mice were prepared as previously described with modifications [41]. Briefly, testis tubules were washed once with PBS, fixed in 5 ml 4% PFA for 3 hours, and incubated sequentially with 5 ml of 25%, 50%, 75% and 100% TBST (1×TBS containing 0.1% Tween 20) at 4°C each for 30 minutes. Testis tubules were frozen in 1×TBS at -20°C. Immunostaining of testis sections, whole mounts of seminiferous tubules, or SSCs was performed with the following primary antibodies: goat anti-LIN28 (1:100), guinea pig anti-ACRV1 (1:500, gift from PP Reddi) [42], rabbit anti-GFP (1:500, Cat# Ab6556, Abcam), anti-PLZF (1:200, Cat# OP128L, Calbiochem), and anti-GFRA1 (1:20, Cat# sc-10716, Santa Cruz Biotech). Texas red or FITC-conjugated secondary antibodies were used (Vector Laboratories). Nuclear DNA was stained with DAPI provided in mounting medium. Samples were visualized under a Zeiss Axioskop 40 fluorescence microscope. Images were captured with an Evolution QEi digital camera (MediaCybernetics) and processed with the Image-Pro software (Phase 3 Imaging Systems). Ngn3-GFP and XXY* miceThe derivation of Ngn3-GFP mice has been described previously [26]. In Ngn3-GFP mice, the enhanced green fluorescent protein (eGFP) substitutes the Ngn3 coding region through gene replacement; thus GFP is under the transcriptional control of all endogenous Ngn3 regulatory elements. Adult (2-month-old) Ngn3-GFP heterozygous mice on a mixed (129/C57BL/6) genetic background were used, because homozygous (Ngn3-/-) mice die by postnatal day 3. XXY* mice were generated by breeding XY* males with wild type females [14]. The care and use of mice were within standard ethical guidelines and were approved by the Institutional Animal Care and Use Committee at the University of Pennsylvania. SSC enrichment, SSC culture, siRNA transfection, and qPCR analysisMouse spermatogonia highly enriched for spermatogonial stem cells (SSCs) were prepared and cultured as previously described [43,44]. Briefly, single-cell suspensions were prepared from eight testes from post-natal day 6~8 C57BL/6 pups by digestion with Trypsin-EDTA (0.25%, Invitrogen) and DNase I (7 mg/ml, Sigma). Cell suspensions were layered on top of a 30% Percoll solution and were centrifuged to enrich germ cells. After resuspension, SSCs were isolated by magnetic activated cell sorting (MACS) using Thy1.2 antibody-conjugated microbeads (Cat#130-049-101, Miltenyi Biotec). Thy1+ cells were seeded at a density of 0.5 – 1.0 × 105 cells per well on 12-well culture plates with mitomycin C-treated STO feeders. Self-renewing SSCs were cultured in a chemically defined serum-free MEMα medium (Invitrogen) containing 0.2% BSA, 10 μg/ml Transferrin, 7.6 μeq/L free fatty acids, 3 × 10-8 M Na2SeO3, 50 μM β-ME, 5 μg/ml Insulin, 60 μM Putrescine, 2 mM L-glutamine, and 10 mM HEPES), 20 ng/ml GDNF (R&D Systems), 150 ng/ml soluble GFRα1 (R&D Systems), and 1 ng/ml bFGF (BD Biosciences). The medium was changed every 2–3 days. All cultures were maintained at 37°C in a humidified 5% CO2 incubator. Cells were passaged at 7-day intervals at 1:2–3 dilution. Mouse Lin28 siRNAs (On-target plus Smartpool, Cat# L-050153, Thermo Scientific Dharmacon) was used. Silence® siRNA served as a negative control (Cat# AM4611, Ambion). After trypsin digestion and washing, SSCs were plated into wells of a 12-well dish without feeders in the antibiotic-free culture medium at a density of 2 × 105 cells/well. Cells were allowed to settle for 2–3 hours prior to siRNA treatment. For each well, 75 pmol of siRNA and 2 μl of LipofectamineTM RNAiMAX reagent (Invitrogen) were mixed with 200 μl of OptiMEM (Invitrogen). After the 30-hour incubation, total RNA and proteins were prepared for qPCR and western blotting. Quantitative RT-PCR (qPCR) analysis was performed using SYBR green on an ABI 7300 sequence detection system with the following Lin28 primers: AGACCAACCATTTGGAGTGC and AATCGAAACCCGTGAGACAC. Level of mature let-7g miRNA was measured by using specific TaqMan probes per the manufacturer's instructions (Applied Biosystems). Quantification of Lin28 and mature let-7g transcript levels was normalized to Rps2 (ribosomal protein S2) within the log phase of the amplification curve. For SSC count, 1 × 105 cells/well after 30-hour siRNA treatment were plated onto fresh feeders, cultured in a defined serum-free media with 20 ng/ml GDNF, 150 ng/ml GFRα1 and 1 ng/ml bFGF for 7 days. Each experiment was performed on three independent SSC lines. Authors' contributionsKZ and XW performed experiments. XW and KHK contributed material. PJW and KZ wrote the manuscript. All authors have seen, commented, and approved the final manuscript. AcknowledgementsWe thank R. L. Brinster, S. Dinardo, and D. Yu for suggestions. We are grateful to P. P. Reddi for anti-ACRV1 antibodies, J. Pan for tissue samples, K. Brondell for technical assistance, R. L. Brinster and F. Yang for comments on the manuscript. References
Have something to say? Post a comment on this article! |




on Google Scholar








author email
corresponding author email
Figure 1.
Figure 2.
Figure 3.
Figure 4.
Figure 5.
Figure 6.